Precision Genome Editing: Correcting CFTR F508del with Prime Editing for Cystic Fibrosis Therapy

Christian Bailey Jan 09, 2026 442

This article provides a comprehensive analysis for research scientists and drug development professionals on applying prime editing to correct the pathogenic CFTR F508del mutation in cystic fibrosis.

Precision Genome Editing: Correcting CFTR F508del with Prime Editing for Cystic Fibrosis Therapy

Abstract

This article provides a comprehensive analysis for research scientists and drug development professionals on applying prime editing to correct the pathogenic CFTR F508del mutation in cystic fibrosis. We explore the foundational biology of the mutation and its consequences, detail the step-by-step methodological pipeline for prime editing design and delivery, address critical troubleshooting and optimization challenges for enhancing editing efficiency and specificity, and compare prime editing to other therapeutic modalities like correctors, ASOs, and base editors. The article concludes by synthesizing the current state of the field, highlighting translational hurdles, and outlining future research directions toward clinical application.

Understanding the Target: The Pathobiology of CFTR F508del and the Rationale for Gene Correction

CFTR Protein Function and the Critical Role of the ΔF508 Deletion

The Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) is a cAMP-regulated anion channel primarily conducting chloride and bicarbonate ions across apical membranes of epithelial cells. Its proper function is critical for maintaining fluid homeostasis in the lungs, pancreas, liver, and intestines.

The most common disease-causing mutation is the in-frame deletion of phenylalanine at position 508 (ΔF508 or F508del), present in at least one allele in ~85% of cystic fibrosis (CF) patients. This mutation disrupts CFTR processing, stability, and function through a multi-faceted mechanism.

Table 1: Quantitative Impact of the ΔF508 Mutation on CFTR

Parameter Wild-Type CFTR ΔF508-CFTR Measurement Context
Maturation Efficiency ~70-80% <1% Percentage of complex-glycosylated (Band C) protein exiting the ER
Cell Surface Stability ~24-48 hours <12 hours Protein half-life at the plasma membrane
Channel Open Probability (Po) ~0.1-0.5 ~0.01-0.05 In excised membrane patches with PKA phosphorylation and ATP
Chloride Conductance ~6-10 pS ~1-3 pS Single-channel conductance at physiological conditions
Thermal Denaturation (Tm) ~45-47°C ~40-41°C Melting temperature, indicative of structural instability

Core Experimental Protocols

Protocol 1: Assessing CFTR Maturation via Western Blot Objective: Quantify the processing defect of ΔF508-CFTR by comparing core-glycosylated (Band B) and mature, complex-glycosylated (Band C) forms.

  • Cell Culture & Lysis: Culture transfected or endogenous CFTR-expressing epithelial cells (e.g., HEK-293, CFBE41o-). Wash with PBS and lyse in RIPA buffer with protease inhibitors.
  • Glycosidase Treatment (Optional): Treat half of each lysate with Endoglycosidase H (Endo H). Band B is Endo H-sensitive; Band C is Endo H-resistant.
  • Electrophoresis & Blotting: Resolve 20-40 µg total protein on a 4-12% Bis-Tris gel. Transfer to PVDF membrane.
  • Immunodetection: Block membrane, then incubate with mouse anti-CFTR antibodies (e.g., Clone 596, 570 from CFFT/CFF). Use HRP-conjugated secondary antibody and chemiluminescent detection.
  • Analysis: Densitometry of Band B (immature, ER-localized) vs. Band C (mature, post-Golgi) determines maturation efficiency.

Protocol 2: Functional Assessment by Halide-Sensitive YFP Quench Assay Objective: Measure CFTR-mediated anion conductance in live cells.

  • Cell Seeding: Plate cells (e.g., FRT epithelial cells) stably expressing CFTR and the halide-sensitive YFP-F46L/H148Q/I152L in a 96-well black-walled plate.
  • CFTR Stimulation: Incubate with forskolin (10 µM) and a potentiator (e.g., VX-770, 1 µM) for 30 min at 37°C.
  • Fluorescence Quench: Using a plate reader, add an iodide-rich solution (e.g., 137 mM NaI) to each well. Measure YFP fluorescence (excitation 488 nm, emission 535 nm) every 1-2 seconds for 20 seconds.
  • Data Calculation: Fit the fluorescence decay curve to a single exponential. The initial rate of quenching is proportional to CFTR-mediated iodide influx. Normalize to forskolin/VX-770 response in WT-CFTR cells.

Protocol 3: Prime Editing for ΔF508 Correction Objective: Correct the F508del mutation in genomic DNA using prime editing guide RNA (pegRNA)-mediated replacement.

  • pegRNA Design: Design pegRNA to target the human CFTR exon 11 sequence (e.g., GRCh38 chr7:117,199,192-117,199,194). The pegRNA scaffold must contain a reverse transcriptase template encoding the three missing nucleotides (TTT or TTC for Phe508) and an appropriate PBS (primer binding site, ~13 nt). Include an nCas9(H840A) nickase gRNA targeting the non-edited strand.
  • RNP Complex Formation: Complex purified PEmax protein (or equivalent) with the synthesized pegRNA and nicking sgRNA in a 1:2:2 molar ratio in duplex buffer. Incubate 10 min at room temperature.
  • Cell Delivery: For immortalized CF patient bronchial epithelial cells, electroporate 1e6 cells with 100 pmol RNP complex using the Neon system (e.g., 1400V, 20ms, 2 pulses).
  • Culture & Expansion: Plate cells in pre-warmed culture medium. Allow recovery for 72 hours before expanding.
  • Genotyping: Harvest genomic DNA. Perform PCR on the target region and analyze by Sanger sequencing or next-generation sequencing (NGS) to determine editing efficiency and purity. Screen for potential off-target edits.

Visualizations

F508del_Defect WT Wild-Type CFTR Translation & Folding ER_Exit_WT ER Quality Control PASS WT->ER_Exit_WT Golgi_WT Golgi Processing (Complex Glycosylation) ER_Exit_WT->Golgi_WT PM_WT Plasma Membrane Stable Localization High Open Probability Golgi_WT->PM_WT Func_WT Normal Chloride & Bicarbonate Transport PM_WT->Func_WT Mut ΔF508-CFTR Translation & Misfolding ER_Retain ER Quality Control FAIL (Recognition by Hsp70/CHIP) Mut->ER_Retain Degrade Polyubiquitination & Proteasomal Degradation (~99%) ER_Retain->Degrade Majority PM_Mut Reduced Plasma Membrane Delivery (If Escapes ER) ER_Retain->PM_Mut <1% Escapes Instability Accelerated Endocytosis & Lysosomal Degradation (Thermal Instability) PM_Mut->Instability Func_Loss Severely Reduced Channel Activity PM_Mut->Func_Loss

Diagram 1: ΔF508-CFTR Biogenesis and Functional Defects

Correction_Strategies Target ΔF508-CFTR Phenotype S1 Correctors (e.g., VX-809, VX-661) Improve Folding & ER Exit Target->S1 S2 Potentiators (e.g., VX-770) Enhance Channel Gating Target->S2 S3 Stabilizers/Amplifiers (e.g., PTI-428) Increase Protein Production Target->S3 S4 Read-through Agents (For Nonsense Mutations) Target->S4 S5 Gene Editing (Prime Editing) Genomic Correction of F508del Target->S5 O1 Increased Band C (Mature Protein) S1->O1 O2 Higher Open Probability S2->O2 O3 More Target Protein Available S3->O3 O4 Full-length Protein Synthesis S4->O4 O5 Permanent Restoration of Wild-Type Sequence & Function S5->O5 Goal Combined Outcome: Synergistic Restoration of CFTR Function at Plasma Membrane O1->Goal O2->Goal O3->Goal O4->Goal O5->Goal

Diagram 2: Therapeutic Strategies Targeting ΔF508-CFTR

The Scientist's Toolkit: Research Reagent Solutions

Table 2: Key Reagents for ΔF508-CFTR Research

Reagent/Solution Primary Function Example Product/Catalog
CFTR Modulator Compounds Pharmacological correction of ΔF508 defects. Corrector (VX-809) aids folding; Potentiator (VX-770) improves gating. Selleckchem CFTRi-1 (VX-809), CFTRi-2 (VX-770)
Anti-CFTR Antibodies Detect immature (Band B) and mature (Band C) CFTR via Western blot, immunoprecipitation, or immunofluorescence. Monoclonal Antibody 596 (anti-C terminus, Univ. of Iowa), Clone 570 (CFFT)
Halide-Sensitive YFP Plasmids Enable live-cell, plate reader-based functional assays of CFTR-mediated anion transport. Addgene plasmid #124091 (pcDNA5/FRT/YFP-F46L/H148Q/I152L)
CFTRinh-172 Specific, reversible small-molecule inhibitor of CFTR channel activity. Essential negative control for functional assays. Sigma-Aldrich C2992
Prime Editing System All-in-one plasmid or protein/RNA components for precise genomic correction of F508del without double-strand breaks. Addgene kits #132465 (PE3) or purified PEmax protein (ToolGen)
CF Patient-Derived Cell Lines Physiologically relevant models for testing correctors and editing. CFBE41o- (homozygous F508del), primary Human Bronchial Epithelial (HBE) cells
Endoglycosidase H (Endo H) Enzymatically distinguishes ER-localized (Endo H-sensitive) from Golgi-processed (Endo H-resistant) CFTR. NEB P0702S
Forskolin & IBMX Elevate intracellular cAMP, activating PKA and phosphorylating CFTR to open the channel. Sigma F3917 (Forskolin), I5879 (IBMX)

Within the broader thesis on CFTR F508del correction via prime editing for cystic fibrosis (CF) research, understanding the precise cellular pathophysiology of the F508del mutation is foundational. This allele, present in ~85% of CF patients, results in a triad of interconnected defects: protein misfolding, endoplasmic reticulum (ER) retention, and premature degradation. This application note details the molecular mechanisms and provides validated protocols for their study, essential for evaluating prime editing correction strategies and novel pharmacological correctors.

The data below quantifies the severe trafficking and stability deficit of F508del-CFTR compared to wild-type (WT) CFTR.

Table 1: Comparative Biogenesis and Stability Metrics of WT vs. F508del-CFTR

Parameter WT-CFTR F508del-CFTR Measurement Method
Maturation Efficiency ~20-40% <1% Band C / (Band B + Band C) by immunoblot
ER Exit Half-life (t½) ~30-60 min Indefinite (does not exit) Cycloheximide chase, ER compartment isolation
Plasma Membrane Half-life (t½) ~12-24 hours ~3-5 hours (if rescued) Cell-surface biotinylation chase
Ubiquitination Level Low >10-fold increase Immunoprecipitation + anti-ubiquitin blot
Functional Activity (CFTR Channel Conductance) 100% (Reference) <1% (unrescue d) Short-circuit current (Isc) in Ussing chamber

Core Signaling Pathways and Cellular Workflows

Diagram 1: F508del CFTR ERAD Pathway

G CFTR_F508del CFTR F508del mRNA Translation Misfolded_Protein Misfolded CFTR (NBD1 instability) CFTR_F508del->Misfolded_Protein ER_Retention ER Retention (Chaperone Binding: Hsp70, Hsp90, Calnexin) Misfolded_Protein->ER_Retention Ubiquitination Ubiquitination (E3 Ligases: RMA1, CHIP) ER_Retention->Ubiquitination No_Surface_Traffic No Plasma Membrane Trafficking ER_Retention->No_Surface_Traffic Retrotranslocation Retrotranslocation (Via ERAD machinery) Ubiquitination->Retrotranslocation Degradation Proteasomal Degradation (26S Proteasome) Retrotranslocation->Degradation

Diagram 2: Experimental Workflow for Analysis

G Start Cell Model (CFBE, Primary HBE, HEK293) Step1 1. Misfolding Assay (Immunoblot: Band B vs. C) & Limited Proteolysis Start->Step1 Step2 2. ER Retention Assay (Confocal Co-localization: CFTR + ER Marker) Step1->Step2 Step3 3. Ubiquitination Assay (IP: CFTR → Blot: Ubiquitin) Step2->Step3 Step4 4. Degradation Assay (Cycloheximide Chase ± Proteasome Inhibitor) Step3->Step4 Step5 5. Functional Rescue (Corrector Treatment → Isc) Step4->Step5 Data Integrated Data Analysis for Prime Editing Evaluation Step5->Data

Detailed Experimental Protocols

Protocol 1: Pulse-Chase Analysis & Immunoblotting for CFTR Maturation

  • Objective: Quantify maturation efficiency (Band C formation) and half-life of F508del-CFTR.
  • Materials: CFBE41o- cells stably expressing F508del-CFTR, methionine/cysteine-free DMEM, [³⁵S]-EasyTag EXPRESS protein labeling mix, Cycloheximide (100 µg/mL), CFTR-specific antibodies (e.g., MM13-4 for mature, 570 for immature), Protein A/G beads.
  • Procedure:
    • Starve cells in methionine/cysteine-free medium for 30 min.
    • Pulse: Incubate with [³⁵S] labeling mix for 20 min.
    • Chase: Replace medium with complete medium containing excess unlabeled methionine/cysteine. Harvest cells at time points (0, 30, 60, 120, 240 min).
    • Lyse cells in RIPA buffer with protease inhibitors.
    • Immunoprecipitate CFTR overnight at 4°C using anti-CFTR antibody.
    • Wash beads, elute protein, and separate by SDS-PAGE.
    • Visualize bands using a phosphorimager. Quantify Band B (core-glycosylated, ER) and Band C (complex-glycosylated, mature) intensity.

Protocol 2: ER Retention Co-localization Assay (Immunofluorescence)

  • Objective: Visualize and quantify ER retention of F508del-CFTR.
  • Materials: Fixed CFBE cells, primary antibodies (mouse anti-CFTR, rabbit anti-Calnexin or PDI), fluorescent secondary antibodies (e.g., Alexa Fluor 488, 568), confocal microscope, co-localization analysis software (e.g., ImageJ with JACoP plugin).
  • Procedure:
    • Culture cells on glass coverslips. Fix with 4% PFA for 15 min and permeabilize with 0.1% Triton X-100.
    • Block with 5% BSA for 1 hour.
    • Incubate with primary antibodies diluted in blocking buffer overnight at 4°C.
    • Wash and incubate with species-specific secondary antibodies for 1 hour at RT.
    • Mount and image using a confocal microscope with sequential scanning.
    • Calculate Manders' or Pearson's co-localization coefficients between CFTR and ER marker signals.

Protocol 3: Ubiquitination Assay

  • Objective: Detect polyubiquitination of F508del-CFTR.
  • Materials: HEK293 cells transfected with F508del-CFTR and HA-tagged ubiquitin, MG132 proteasome inhibitor (10 µM, 6h treatment), Lysis buffer (1% SDS + PBS with protease inhibitors), Dilution buffer (1% Triton X-100 in PBS), Anti-CFTR antibody (for IP), Anti-HA antibody (for blot).
  • Procedure:
    • Treat cells with MG132 to inhibit degradation.
    • Lyse cells in 1% SDS buffer and boil for 5 min to dissociate complexes.
    • Dilute lysate 10-fold with Triton-based buffer.
    • Pre-clear lysate, then incubate with anti-CFTR antibody overnight.
    • Pull down with Protein A/G beads, wash extensively.
    • Elute and run SDS-PAGE. Perform immunoblotting with anti-HA antibody to detect ubiquitinated CFTR species (high molecular weight smearing).

The Scientist's Toolkit: Key Research Reagent Solutions

Table 2: Essential Reagents for Studying F508del Cellular Consequences

Reagent / Material Supplier Examples Function in Research
CFBE41o- F508del/- Cell Line CFFT/CWRU, ATCC Gold-standard human bronchial epithelial model homozygous for F508del.
Correctors (VX-809, VX-445) Selleckchem, MedChemExpress Pharmacological chaperones used as positive controls to partially rescue F508del trafficking.
Proteasome Inhibitor (MG132) Sigma-Aldrich, Cayman Chemical Inhibits the 26S proteasome, allowing accumulation of ubiquitinated CFTR for detection.
Cycloheximide Thermo Fisher, Sigma-Aldrich Translation inhibitor used in chase experiments to monitor protein turnover.
CFTR Antibodies (Clone MM13-4, 570) Millipore, CFFT Antibodies specific for mature (MM13-4) and immature (570) CFTR for immunoblot and IP.
ER Marker Antibodies (Calnexin, PDI) Abcam, Cell Signaling Markers for immunofluorescence co-localization studies to confirm ER retention.
Prime Editing RNP Components IDT, Synthego Cas9 nickase-HF1 protein, prime editing guide RNA (pegRNA), reverse transcriptase template for precise correction.
Ussing Chamber System Warner Instruments, Physiologic Instruments For functional validation via transepithelial short-circuit current (Isc) measurements.

Table 1: Efficacy and Population Coverage of Approved CFTR Modulators

Modulator (Brand Name) Target CFTR Mutation(s) Approx. % of CF Population Covered Average ppFEV1 Improvement (Baseline) Key Limitations (Quantitative)
Trikafta (elexacaftor/tezacaftor/ivacaftor) F508del (homozygous or heterozygous) + min. 1 responsive allele ~90% +10-15% (Phase 3 trials) Residual lung function gap ~30% vs. non-CF; sweat chloride remains elevated (~40-50 mmol/L); organ-specific variation.
Orkambi (lumacaftor/ivacaftor) F508del homozygous ~45% +2-4% (Phase 3 trials) Modest clinical benefit; significant drug-drug interactions; adverse event profile.
Kalydeco (ivacaftor) Gating mutations (e.g., G551D) ~4-5% +10% Very narrow population coverage; high cost per patient.
Symdeko (tezacaftor/ivacaftor) F508del homozygous or heterozygous with residual function ~70% +4-6% Suboptimal efficacy vs. Trikafta; does not address all F508del defects.

Table 2: Prime Editing vs. Modulators for F508del Correction

Parameter CFTR Modulators (Trikafta) Prime Editing Genetic Correction
Mechanism Pharmacological chaperone & potentiator Precise genomic DNA correction
Effect Duration Requires lifelong daily dosing Potentially single treatment, permanent
Target Specificity All cells expressing CFTR Can be directed to specific cell types
Correction Rate N/A (modulates existing protein) Demonstrated in vitro up to ~60% editing efficiency (in primary cells)
Off-target Risk Off-target pharmacological effects Requires careful gRNA design & off-target assessment
Sweat Chloride Normalization Partial (mean ~40-50 mmol/L) Theoretical full normalization if editing efficiency high

Experimental Protocols for Prime Editing in CFTR-F508del Models

Protocol 2.1: Design and Validation of Prime Editing Guide RNAs (pegRNAs) for F508del Correction

Objective: To design and test pegRNAs for precise correction of the F508del mutation (c.15211523delCTT) to wild-type sequence (c.15211523CTT) in the CFTR gene. Materials:

  • Genomic DNA from CF patient-derived cells (F508del homozygous).
  • Prime Editor 2 (PE2) plasmid (Addgene #132775).
  • pegRNA design software (e.g., pegFinder, PrimeDesign).
  • In vitro transcription kit for pegRNA synthesis.
  • Surveyor or T7 Endonuclease I mismatch detection assay kit.
  • Next-generation sequencing (NGS) library prep kit.

Procedure:

  • pegRNA Design: Using the reference sequence (NG_016465.4), design a pegRNA containing:
    • A 13-nt 5' spacer sequence targeting the non-coding strand 3' of the deletion.
    • A scaffold compatible with S. pyogenes Cas9 H840A nickase.
    • A 3' extension encoding the reverse complement of the wild-type template (including the 3-nt CTT insertion) and a primer binding site.
  • Cloning: Clone synthesized pegRNA sequences into a U6-driven expression vector.
  • Transfection: Co-transfect PE2 plasmid and pegRNA plasmid into patient-derived bronchial epithelial cells (e.g., CFBE41o-) using a nucleofection system optimized for primary cells.
  • Efficiency Assessment (72h post-transfection): a. Extract genomic DNA. b. PCR amplify a ~500bp region surrounding the target site. c. Perform NGS amplicon sequencing. Calculate editing efficiency as (% reads with precise CTT insertion) / (% total reads at locus).
  • Functional Validation: For successfully edited pools, perform forskolin-induced swelling assay in 3D organoid cultures and measure sweat chloride in air-liquid interface (ALI) cultures.

Protocol 2.2:In VitroCorrection and Functional Assay in Primary Human Bronchial Epithelial Cells (HBECs)

Objective: To correct F508del in primary HBECs and assess CFTR function via electrophysiology. Materials:

  • Primary HBECs from F508del homozygous donor (commercially sourced).
  • PE2 ribonucleoprotein (RNP) complex: recombinant PE2 protein + in vitro transcribed pegRNA.
  • P3 Primary Cell 4D-Nucleofector X Kit (Lonza).
  • ALI culture media and inserts.
  • USsing chamber setup with voltage clamp.
  • CFTR corrector/potentiator compounds (VX-809, VX-770) for comparator arms.

Procedure:

  • Cell Preparation: Expand primary HBECs in proliferative media. Passage at 80% confluency.
  • Nucleofection: For 1e6 cells, mix 10 µg recombinant PE2 protein and 5 µg pegRNA. Incubate 10 min to form RNP. Use nucleofection program EN-158. Immediately add pre-warmed culture media.
  • ALI Culture: Seed nucleofected cells on Transwell inserts. Allow to reach confluency, then raise apical side to air. Culture for 21-28 days to achieve full differentiation.
  • USsing Chamber Measurement: a. Mount ALI cultures in modified USsing chambers bathed in symmetrical Krebs bicarbonate solution. b. Measure baseline short-circuit current (Isc). c. Add amiloride (100 µM, apical) to block ENaC. d. Add forskolin (10 µM, bilateral) and VX-770 (1 µM, apical) to activate CFTR. e. Add CFTR inhibitor-172 (20 µM, apical) to confirm CFTR-specific current.
  • Analysis: Compare forskolin/VX-770 stimulated ΔIsc between edited, unedited, and wild-type control cells.

Diagrams

G Figure 1. Limitations of Modulators vs. Genetic Correction cluster_mod Current Modulators (e.g., Trikafta) cluster_gen Prime Editing Genetic Approach M1 Partial correction of processing & gating M2 Lifelong daily dosing M3 Variable organ response M4 Residual inflammation M5 High treatment burden Root F508del CF Phenotype (Defective folding, trafficking, gating) M5->Root cessation returns G1 Genomic DNA correction at CFTR locus G2 Potential one-time treatment G2->Root if durable G3 Endogenous regulation preserved G4 Theoretical full function restoration G5 Delivery & safety hurdles remain Root->M1 addresses Root->G1 corrects

Title: Modulator vs. Genetic Correction for F508del-CF

G Figure 2. Prime Editing Workflow for CFTR-F508del Start 1. Design pegRNA: - 13-nt spacer - Wild-type template with 'CTT' - PBS sequence A 2. Deliver PE2 system: - PE2 mRNA or protein - pegRNA Start->A B 3. Target site binding & nicking of non-target strand A->B C 4. Reverse transcription from pegRNA extension B->C D 5. DNA repair & genomic incorporation of corrected sequence C->D E 6. Outcome: Permanent correction (CTT inserted) in genomic DNA D->E F 7. Functional validation: - USsing chamber - Organoid swelling - Single-cell sequencing E->F

Title: Prime Editing Steps for F508del Correction

The Scientist's Toolkit: Research Reagent Solutions

Table 3: Key Reagents for Prime Editing CFTR-F508del Research

Item Function in Experiment Example Product/Catalog # Critical Notes
Prime Editor 2 (PE2) Expression Plasmid Provides the engineered Cas9-reverse transcriptase fusion protein. Addgene #132775 PE2 (M-MLV RT) offers higher fidelity than PE1.
pegRNA Cloning Vector Allows for efficient expression of the pegRNA guide component. Addgene #132777 (pU6-pegRNA-GG-acceptor) Contains necessary U6 promoter and scaffold.
Recombinant PE2 Protein For RNP delivery, reducing off-targets and immune activation. Custom synthesis (e.g., Aldevron) Requires high purity and nuclease-free conditions.
Primary Human Bronchial Epithelial Cells (CF donor, F508del) Therapeutically relevant in vitro model. Commercial providers (e.g., Epithelix, Lonza) Must maintain differentiation capacity post-editing.
4D-Nucleofector System & Kit High-efficiency delivery of RNP complexes into primary cells. Lonza, P3 Primary Cell 4D-Nucleofector X Kit Program optimization is essential for cell viability.
Amplicon-EZ NGS Service Quantifies precise editing efficiency and identifies byproducts. GENEWIZ Amplicon-EZ Requires deep sequencing (>10,000x coverage).
Organoid Culture Medium (Intestinal/Ferret) For functional forskolin-induced swelling assay (FIS). STEMCELL Technologies IntestiCult Robust functional readout of CFTR correction.
VX-809 (Lumacaftor) & VX-770 (Ivacaftor) Small molecule comparator controls for functional assays. Selleckchem S1565 & S1144 Benchmarks for "partial correction" vs. genetic cure.
CFTR Inhibitor-172 Validates CFTR-specific current in electrophysiology. Sigma-Aldrich C2992 Specific blocker for confirmatory USsing steps.
T7 Endonuclease I For initial, rapid assessment of editing indels (pre-NGS). NEB M0302S Less accurate for prime editing's small changes.

This application note details the fundamentals of prime editing (PE), a "search-and-replace" genome editing technology. The content is framed within the ongoing research for the therapeutic correction of the CFTR F508del mutation, the most common cause of cystic fibrosis (CF). Precise correction of this three-base-pair deletion to restore wild-type sequence and CFTR function represents a prime application for PE's versatility and precision, offering a potential path to a one-time curative therapy.

Prime editing uses a fusion protein consisting of a Cas9 nickase (H840A) reverse transcriptase (RT) and a prime editing guide RNA (pegRNA). The pegRNA both specifies the target site and encodes the desired edit. The system directly writes new genetic information into a specified DNA site without requiring double-strand breaks (DSBs) or donor DNA templates, minimizing undesired byproducts like indels.

Table 1: Comparison of Prime Editor Systems for CFTR F508del Correction In Vitro

Editor System Correction Efficiency (HEK293T, %) Indel Rate (%) Purity (Correction/Indels) Key Features Primary Reference
PE2 5-15% 0.5-2.0% ~10:1 Basic system; moderate efficiency. Anzalone et al., 2019
PE3 15-30% 1.0-5.0% ~6:1 Uses nicking sgRNA to increase HDR; higher indel rate. Anzalone et al., 2019
PE3b 10-25% 0.2-1.5% ~20:1 Nicking sgRNA targets edited strand; improved purity. Anzalone et al., 2019
ePE 25-55% 0.5-3.0% ~18:1 Engineered RT & pegRNA enhancements. Chen & Liu, 2021

Table 2: Delivery Methods for Prime Editing in CF Models

Delivery Method Target Cell/Model Advantages Challenges for CF Therapy
AAV Vectors In vitro cell lines, murine airways High infectivity of dividing & non-dividing cells. Limited packaging capacity (~4.7kb) for PE. Requires dual-AAV or split systems.
Lipid Nanoparticles (LNPs) Primary human bronchial epithelial (HBE) cells High delivery efficiency; transient expression. Optimization for lung delivery; potential immunogenicity.
Electroporation (mRNA/RNP) iPSCs, immortalized cell lines High precision, minimal off-target integration. Not suitable for in vivo delivery to lung tissue.

Detailed Protocol: F508del Correction in HEK293T Cells

Protocol 3.1: Prime Editing forCFTRCorrection

Objective: To correct the F508del mutation in CFTR exon 11 using PE2/PE3 systems in HEK293T cells. Materials: See Scientist's Toolkit below.

Part A: pegRNA and sgRNA Design

  • Target Identification: The wild-type sequence at the F508 locus is ...ATC ATC TTT GGT GTT... (coding strand). The common F508del mutation is a deletion of CTT (corresponding to phenylalanine 508).
  • pegRNA Design:
    • Spacer Sequence: 20-nt guide sequence targeting the genomic site immediately 3' of the F508del deletion.
    • PBS Sequence: Design a 13-nt primer binding site (PBS) complementary to the 3' end of the nicked, displaced DNA flap. Optimize length (10-15 nt) using design tools.
    • RT Template: Must contain (5' to 3'): the desired corrective CTT insertion, followed by homology to the sequence 5' of the nick site. Total length ~10-20 nt.
  • Nicking sgRNA Design (for PE3/PE3b): Design a standard sgRNA to nick the non-edited strand (PE3) or the edited strand (PE3b) 50-150 bp away from the pegRNA cut site.

Part B: Plasmid or RNP Assembly

  • Plasmid-based (Common): Co-transfect cells with 1) a plasmid expressing the PE2 (Cas9 nickase-RT) protein and 2) a plasmid expressing the pegRNA (and nicking sgRNA for PE3).
  • RNP-based (High Purity): Complex purified PE2 protein with in vitro-transcribed pegRNA (and nicking sgRNA) to form ribonucleoprotein (RNP) complexes for electroporation.

Part C: Cell Transfection and Harvest

  • Seed HEK293T cells in a 24-well plate to reach 70-80% confluency at transfection.
  • For plasmid transfection: Use 500 ng PE2 expression plasmid and 250 ng pegRNA plasmid (plus 250 ng nicking sgRNA plasmid for PE3) with a suitable transfection reagent (e.g., Lipofectamine 3000). Follow manufacturer's protocol.
  • Incubate cells for 72 hours to allow for editing and expression.
  • Harvest genomic DNA using a commercial extraction kit.

Part D: Analysis of Editing Outcomes

  • PCR Amplification: Amplify the target region (~300-500 bp surrounding the edit site) from genomic DNA.
  • Next-Generation Sequencing (NGS): Perform amplicon sequencing. Analyze sequences for:
    • Precise Correction: Perfect restoration of the wild-type CTT codon.
    • Indel Frequency: Insertions/deletions at the pegRNA or nicking sgRNA cut sites.
    • Undesired Byproducts: Unintended point mutations or translocations.
  • Functional Assay (Follow-up): In corrected cell models, assess CFTR chloride channel function via halide-sensitive YFP assay or using Ussing chamber measurements on differentiated epithelial monolayers.

Visualization: Mechanisms and Workflows

G cluster_1 1. Target Complex Formation cluster_2 2. Reverse Transcription & Flap Resolution cluster_3 3. Outcome Title Prime Editor Mechanism for CFTR F508del Correction PE_Complex PE2 Complex (Cas9n-RT/pegRNA) Binding pegRNA Spacer Binds Target Cas9n Nicks Non-Target Strand PE_Complex->Binding Genomic_DNA Genomic DNA (CFTR F508del allele) Genomic_DNA->Binding RT PBS Hybridizes, RT Extends Adding Correct 'CTT' Codon Binding->RT Resolution DNA Repair Resolves Flap Incorporating Correction RT->Resolution Corrected_DNA Corrected Wild-Type CFTR DNA Resolution->Corrected_DNA Nicked_Strand Optional Nicking sgRNA (PE3) Stimulates Repair Nicked_Strand->Resolution

Diagram Title: PE2/PE3 Mechanism for Correcting CFTR F508del

G Title Workflow for CFTR F508del Prime Editing Experiment Step1 1. Design pegRNA & Nicking sgRNA Step2 2. Assemble Editor (Plasmid or RNP) Step1->Step2 Step3 3. Deliver to Cells (Transfect/Electroporate) Step2->Step3 Step4 4. Harvest & Isolate genomic DNA (72h) Step3->Step4 Step5 5. PCR Amplicon Sequencing (NGS) Step4->Step5 Step6 6. Analyze Outcomes: - % Correction - % Indels - Purity Step5->Step6 Step7 7. Functional Validation (e.g., YFP Assay) Step6->Step7

Diagram Title: Experimental Workflow for CFTR Prime Editing

The Scientist's Toolkit: Research Reagent Solutions

Table 3: Essential Materials for Prime Editing CFTR Experiments

Item Function/Description Example Product/Catalog
PE2 Expression Plasmid Expresses the Cas9 nickase-reverse transcriptase fusion protein. Core editor component. pCMV-PE2 (Addgene #132775)
pegRNA Expression Scaffold Plasmid backbone for cloning and expressing custom pegRNA sequences. pU6-pegRNA-GG-acceptor (Addgene #132777)
Nicking sgRNA Plasmid For PE3/PE3b systems; expresses sgRNA to nick the non-edited/edited strand. pU6-sgRNA expression vectors
Cell Line with F508del Disease-relevant model for editing. CFBE41o- (homozygous F508del bronchial epithelial), HEK293T (transfection control)
Lipofectamine 3000 Transfection reagent for plasmid delivery into mammalian cell lines. Thermo Fisher Scientific, L3000015
Neon Transfection System Electroporation system for high-efficiency delivery of RNP complexes. Thermo Fisher Scientific, MPK5000
KAPA HiFi HotStart ReadyMix High-fidelity PCR polymerase for generating NGS amplicons with minimal errors. Roche, KK2602
Illumina MiSeq System Next-generation sequencing platform for deep sequencing of edited amplicons. Illumina, SY-410-1003
CRIS.py / CRISPResso2 Bioinformatics software for quantifying prime editing outcomes from NGS data. Open-source tools
YFP Halide Sensor Assay Kit Functional assay to measure CFTR chloride channel activity post-correction. Addgene, various constructs (e.g., pYFP-F46L/H148Q/I152L)

Cystic fibrosis (CF) is caused by mutations in the CFTR gene. The F508del mutation (deletion of phenylalanine at position 508) is present in ~85% of CF patients in at least one allele and presents a unique, multifaceted challenge. It causes both protein misfolding/degradation and defective channel gating. Prime editing, a versatile "search-and-replace" genome editing technology, offers a precise correction strategy without requiring double-strand DNA breaks or donor templates, making F508del a prime candidate for its application.

The F508del Mutation: A Quantitative Profile

Table 1: Molecular and Clinical Impact of the F508del Mutation

Parameter Wild-Type CFTR F508del CFTR Measurement/Notes
Prevalence N/A ~70% of all CF alleles Global average
Protein Processing ~70-80% reaches mature form (Band C) <1% reaches mature form Quantified by Western blot in epithelial cells
Cell Surface Stability Half-life >24 hours Half-life <4 hours Measured by pulse-chase & biotinylation
Channel Open Probability (Po) ~0.4-0.5 ~0.01-0.03 Measured by patch-clamp electrophysiology
Functional Correction Requirement N/A Partial restoration (10-30% of WT) can yield clinical benefit Based on modulator therapy data

Prime Editing System Components for F508del Correction

Table 2: Prime Editing Research Reagent Toolkit

Reagent / Material Function in F508del Correction Example/Notes
Prime Editor (PE) Construct Expresses fusion protein of Cas9 nickase (H840A) and reverse transcriptase (RT). PE2 is the standard; PE3 uses an additional sgRNA to nick the non-edited strand.
Prime Editing Guide RNA (pegRNA) Directs PE to target locus and encodes the desired edit via its RT template. Contains: 1) spacer for F508 site, 2) scaffold, 3) primer binding site (PBS), 4) RT template with "CTT" insertion.
nicking sgRNA (for PE3/PE3b) Induces a nick in the non-edited strand to bias DNA repair toward the edited strand. Designed complementary to the edited strand, 50-100 bp from the pegRNA cut site.
Delivery Vector (AAV, LV, LNP) Enables efficient transduction of PE components into target cells (e.g., airway epithelia). AAV serotypes 5 or 6 common for lung delivery; LNPs for mRNA/protein delivery.
CF Airway Epithelial Cell Model In vitro system to assess correction efficiency and functional rescue. Primary human bronchial epithelial (HBE) cells or immortalized lines (CFBE41o-).
Ussing Chamber Apparatus Gold-standard functional assay to measure CFTR-dependent chloride current restoration. Measures short-circuit current (Isc) after forskolin/IBMX stimulation.

Protocol: Prime Editing for F508del Correction in CFBE41o- Cells

Design of pegRNA and nicking sgRNA

  • Target Sequence: Identify the genomic sequence around the F508del locus (chr7:117,199,120-117,199,130 in GRCh38/hg38). Wild-type codon for 508 is "ATT" (Isoleucine) "TTC" (Phenylalanine) "TTC" (Phenylanine). F508del deletes the second "TTC".
  • pegRNA Design:
    • Spacer Sequence: Design a 20-nt spacer targeting the immediate sequence 5' of the PAM (NGG) near the deletion. Example: GGCACCATTAAAGAAAATATCATCT
    • PBS Length: Optimize length (typically 10-15 nucleotides) for the specific locus. Start with 13 nt.
    • RT Template: Must include the desired correction (insertion of "CTT") and any necessary synonymous changes to prevent re-cutting. Design: [5' - CTT insertion + ~10-15 nt homology 3' of edit - 3'].
  • nicking sgRNA Design (for PE3): Design a standard sgRNA to nick the non-edited strand. It should bind 50-100 bp from the pegRNA-induced nick site on the opposite strand.

Delivery and Transfection

  • Cell Culture: Maintain CFBE41o- cells homozygous for F508del in appropriate media.
  • Transfection: At 70% confluency in a 24-well plate, co-transfect 500 ng of PE2 expression plasmid and 250 ng of pegRNA expression plasmid using a lipofection reagent. For PE3, also transfect 250 ng of nicking sgRNA plasmid.
  • Controls: Include a non-targeting pegRNA control and an untreated control.

Assessment of Editing Efficiency

  • Genomic DNA Extraction: 72 hours post-transfection, extract gDNA.
  • PCR Amplification: Amplify the targeted region (~300 bp) using high-fidelity PCR.
  • Next-Generation Sequencing (NGS): Prepare amplicon libraries and sequence on a MiSeq platform. Analyze sequences for precise "CTT" insertion and indels.
    • Calculation: % Editing Efficiency = (Reads with precise CTT insertion / Total aligned reads) * 100.

Functional Validation in Polarized Monolayers

  • Generate Clonal Lines: Single-cell sort transfected cells and expand clones. Screen by NGS for homozygous correction.
  • Air-Liquid Interface (ALI) Culture: Differentiate corrected and control clones on Transwell inserts for 4-6 weeks.
  • Ussing Chamber Assay:
    • Mount ALI cultures in the chamber with physiologic buffers.
    • Inhibit epithelial sodium channels (ENaC) with amiloride.
    • Activate CFTR with forskolin (10 µM) and IBMX (100 µM).
    • Measure the resulting short-circuit current (ΔIsc).
    • Apply CFTR inhibitor (CFTRinh-172) to confirm specificity.
  • Western Blot: Confirm appearance of mature, glycosylated Band C CFTR protein in corrected clones.

f508del_pe_workflow start Design pegRNA: Spacer + PBS + RT Template with 'CTT' step1 Co-deliver PE2 & pegRNA (± nicking sgRNA for PE3) to F508del cells start->step1 step2 Prime Editing Reaction: 1. PE binds pegRNA & targets DNA 2. Nicks non-PAM strand 3. PBS hybridizes 4. RT writes correction step1->step2 step3 DNA Repair & Outcome: Edited strand flaps over, repair yields permanent 'CTT' insertion step2->step3 assay1 NGS Quantification: % precise editing & byproduct analysis step3->assay1 assay2 Functional Assays: Ussing Chamber (Isc) Western Blot (Band C) step3->assay2

Prime Editing Workflow for F508del Correction

f508del_cellular_pathway mut F508del Genomic DNA rna Mutant mRNA (ΔF508 codon) mut->rna corr_dna Corrected DNA (F508 restored) mut->corr_dna After PE protein Misfolded CFTR Protein rna->protein erad ERAD (Early Degradation) protein->erad >99% no_surface Minimal Surface CFTR protein->no_surface <1% defect Defective Chloride Transport no_surface->defect pe Prime Editing Correction pe->mut Corrects corr_rna WT mRNA corr_dna->corr_rna corr_protein Properly Folded CFTR corr_rna->corr_protein surface Stable Surface CFTR corr_protein->surface function Restored Chloride Transport surface->function

Cellular Consequences of F508del and Prime Editing Rescue

A Step-by-Step Guide: Designing and Delivering Prime Editing for F508del in CF Models

Within the broader thesis on advancing prime editing for cystic fibrosis (CF) therapy, the correction of the CFTR F508del mutation represents a pivotal challenge and opportunity. This three-base-pair deletion (CTT) in exon 10 of the CFTR gene, resulting in the loss of phenylalanine at position 508, is the most common CF-causing mutation. Prime editing offers a precise "search-and-replace" genomic editing approach without requiring double-strand DNA breaks or donor DNA templates. The efficacy of this system is critically dependent on the optimal design of the prime editing guide RNA (pegRNA), which must perform multiple functions: target binding, primer binding site (PBS) annealing, and encoding the desired edit via the reverse transcriptase template (RTT). This application note details the key sequence considerations and protocols for designing and testing pegRNAs targeting the F508del locus, a cornerstone for developing a definitive genetic correction for CF.

Key Sequence Considerations for pegRNA Design

The pegRNA is a fusion of a sgRNA scaffold with a 3' extension containing the PBS and the RTT. For F508del correction (the restoration of the missing "CTT" codon), the design requires meticulous attention to several parameters.

Core Design Parameters:

  • Spacer Sequence (20 nt): Must specifically bind the target DNA strand adjacent to the F508del locus. The protospacer adjacent motif (PAM; NGG for SpCas9-derived PE2) is located on the non-target strand, 3' of the insertion site.
  • Edit Site Position: The edit (insertion of "CTT") should be placed within the RTT, typically 0-6 nucleotides (nt) downstream of the nick site. For F508del, the nick is induced on the opposite strand from the deletion.
  • Primer Binding Site (PBS): This sequence anneals to the 3' flap generated by the nick to prime reverse transcription. Optimal length is critical.
  • Reverse Transcriptase Template (RTT): Contains the templating sequence for reverse transcription, including the corrective "CTT" insertion and any necessary synonymous changes to prevent re-editing.

Quantitative Design Guidelines from Literature: Current research indicates optimal performance windows for key pegRNA components. The following table summarizes consensus findings from recent studies on prime editing efficiency, applied to the F508del context.

Table 1: Quantitative pegRNA Design Parameters for F508del Correction

Parameter Recommended Range Optimal Value (Consensus) Functional Impact
Spacer Length 20 nt 20 nt Dictates Cas9 binding specificity and nicking efficiency.
PBS Length 8-15 nt 13 nt Shorter PBS may not prime efficiently; longer PBS can reduce editing by stabilizing non-productive complexes.
RTT Length 10-20 nt 15-18 nt (including edit) Must be long enough to template the full edit and any blocking mutations.
Edit-to-Nick Distance 0-10 nt 3-6 nt Positioning the edit too close or too far from the nick site can dramatically reduce efficiency.
PAM-to-Edit Distance Variable N/A Defined by genomic locus. For F508del, the PAM is positioned relative to the complementary strand.
RTT 3' Homology Arm 5-10 nt 8-10 nt Additional homology beyond the edit may improve flap equilibration and incorporation.

Detailed Experimental Protocol: pegRNA Testing for F508del Correction

This protocol outlines the steps to clone, deliver, and assess pegRNAs designed to correct the F508del mutation in a human cell model.

A. pegRNA Design and Cloning

  • Design: Using reference genomic sequence (e.g., GRCh38, chr7:117,199,493-117,199,495 delCTT), identify a suitable NGG PAM sequence on the non-target strand within ~30 bp of the F508del site. Design the spacer sequence (20 nt) complementary to the target strand.
  • Define Edit: The RTT must encode the wild-type sequence: ...TTC TTT GGT GTT TCC... (incorporating the corrective CTT/TTC codon for F508).
  • Add Blocking Mutations: Incorporate 1-2 synonymous mutations in the RTT, 5-10 nt downstream of the edit, to prevent pegRNA re-binding and iterative editing.
  • Synthesize Oligos: Order oligonucleotides for the spacer and the 3' extension (PBS + RTT).
  • Molecular Cloning: Clone the pegRNA sequence into a prime editing backbone plasmid (e.g., pU6-pegRNA-GG-acceptor or similar) via Golden Gate or BsaI-based assembly. Co-clone or prepare a separate plasmid expressing the prime editor (PE2 or PE2max).

B. Cell Culture and Transfection

  • Cell Line: Culture HEK293T cells or, preferably, a homozygous F508del CF bronchial epithelial cell line (e.g., CFBE41o-) in appropriate medium.
  • Transfection: At 70-80% confluency in a 24-well plate, co-transfect 500 ng of PE2(max) expression plasmid and 500 ng of pegRNA plasmid using a lipid-based transfection reagent (e.g., Lipofectamine 3000). Include controls: PE2 only, non-targeting pegRNA.
  • Harvest: Incubate for 72 hours to allow for editing and protein turnover. Harvest genomic DNA using a silica-column based kit.

C. Analysis of Editing Efficiency

  • PCR Amplification: Amplify the target CFTR exon 10 region (~300 bp) using high-fidelity PCR.
  • Next-Generation Sequencing (NGS): Purify PCR amplicons, prepare barcoded libraries, and sequence on an Illumina MiSeq platform (2x300 bp). Aim for >50,000 reads per sample.
  • Data Analysis: Align reads to the reference sequence. Quantify the percentage of reads containing the precise 3-bp insertion, unwanted insertions/deletions (indels), and other unintended edits. Prime editing efficiency is calculated as: (Correctly Edited Reads / Total Aligned Reads) * 100.

Table 2: Key Research Reagent Solutions

Reagent/Material Function/Description Example Product/Catalog
Prime Editor Plasmid (PE2max) Expresses the engineered Cas9(H840A)-M-MLV RT fusion protein. Catalyzes the prime editing reaction. Addgene #174828
pegRNA Cloning Backbone Plasmid with U6 promoter and scaffold for pegRNA insertion. Addgene #132777
Lipofectamine 3000 Lipid nanoparticle reagent for efficient plasmid delivery into mammalian cells. Thermo Fisher L3000001
CFBE41o- Cell Line Immortalized bronchial epithelial cells homozygous for F508del. Relevant disease model. CFF Cat# CFF-16HBEge F508del/F508del
KAPA HiFi HotStart ReadyMix High-fidelity polymerase for accurate amplification of the target locus for NGS. Roche 7958935001
MiSeq Reagent Kit v3 Reagents for 600-cycle paired-end sequencing on Illumina MiSeq. Illumina MS-102-3003
CRISPResso2 Software Bioinformatics tool for quantifying genome editing outcomes from NGS data. https://github.com/pinellolab/CRISPResso2

Visualization of Workflows and Relationships

f508del_pegRNA_design Start Start: F508del Locus (Genomic DNA) Step1 1. Identify PAM (NGG on non-target strand) Start->Step1 Step2 2. Design 20-nt Spacer (complementary to target strand) Step1->Step2 Step3 3. Define Edit: Insert 'CTT' in RTT Step2->Step3 Step4 4. Add Synonymous Blocking Mutations in RTT Step3->Step4 Step5 5. Determine PBS Length (optimal: 13 nt) Step4->Step5 Step6 6. Determine RTT Length (optimal: 15-18 nt) Step5->Step6 Step7 7. Synthesize & Clone Full pegRNA Step6->Step7 End Output: Validated pegRNA Construct Step7->End

pegRNA Design Logic for F508del Correction

pegRNA_workflow PE_Plasmid PE2max Plasmid Transfection Co-Transfection (Lipid Nanoparticles) PE_Plasmid->Transfection pegRNA_Plasmid pegRNA Plasmid pegRNA_Plasmid->Transfection Cells CFBE41o- Cells (F508del/F508del) Cells->Transfection Edited_Cells Edited Cell Population Transfection->Edited_Cells Harvest Harvest genomic DNA Edited_Cells->Harvest PCR PCR Amplification of CFTR Exon 10 Harvest->PCR NGS NGS Library Prep & Sequencing PCR->NGS Analysis Bioinformatics Analysis (CRISPResso2) NGS->Analysis

pegRNA Testing and Analysis Workflow

Prime Editing Mechanism at F508del Locus

Selecting and Optimizing the Prime Editor (PE2, PE3, PE5, PEmax) for CFTR Correction

Within the broader thesis on CFTR F508del correction for cystic fibrosis (CF) research, prime editing offers a precise, versatile, and potentially transformative approach. This document provides application notes and protocols for selecting and optimizing prime editor systems (PE2, PE3, PE5, PEmax) to correct the most common CF-causing mutation, the deletion of phenylalanine at position 508 (F508del).

The optimal editor is selected based on editing efficiency, purity (indel percentage), and delivery constraints.

Table 1: Comparison of Prime Editor Systems for CFTR F508del Correction

Editor System Key Components Mechanism for F508del (c.1521_1523delCTT) Typical Efficiency Range* Key Advantage Key Consideration
PE2 PE2 protein + pegRNA Reverse transcriptase directly writes correction template from pegRNA. 5-15% High product purity; minimal indels. Lower efficiency in many cell types.
PE3 PE2 protein + pegRNA + nicking sgRNA Adds a nick in the non-edited strand to induce repair and increase efficiency. 10-30% Increased editing efficiency over PE2. Higher indel rates at the target site.
PE5 PEmax protein + pegRNA + nicking sgRNA (with MLH1dn) PEmax is an improved editor; MLH1dn suppresses mismatch repair to boost efficiency. 25-55% Highest reported efficiency; reduced MMR interference. Increased complexity; larger payload.
PEmax PEmax protein + pegRNA Improved reverse transcriptase and RT-template binding domains over PE2. 15-35% Enhanced efficiency with PE2-like simplicity. Still benefits from PE3/PE5 strategies.

*Efficiencies are highly dependent on cell type, delivery method, and pegRNA design. Ranges are illustrative based on recent literature in epithelial cell lines.

Selection Guide:

  • For in vitro proof-of-concept with maximal purity: Use PE2.
  • For balancing efficiency and purity in robust cell models: Use PE3 or PEmax.
  • For demanding primary cells (e.g., CF HBE) or therapeutic development: Use PE5 or PEmax+MLH1dn configurations.

Detailed Experimental Protocols

Protocol 3.1: Design of pegRNA for CFTR F508del Correction

Objective: To design the pegRNA that encodes the correction of the CFTR F508del mutation (genomic sequence change: deletion of "CTT" to insertion of "CTT").

  • Identify Target Sequence: The target genomic locus is chr7:117,559,592-117,559,614 (GRCh38), surrounding c.1521_1523.
  • Design Spacer (20 nt): Select a 20-nt sequence 3' to the deletion site for Cas9 binding. Ensure a 'G' at position 1 of the protospacer for U6 expression. Example: 5'-GTTGGTGTTTCCTATGATGA-3'.
  • Define Edit: The correction template must contain the 3-bp "CTT" insertion.
  • Construct pegRNA:
    • Primer Binding Site (PBS): 13-nt length optimal. Start immediately 3' of the edit. Sequence complementary to the non-edited strand after correction.
    • RT Template: Must include the 3-bp "CTT" insertion, flanked by ~10-15 nt of homology on each side to promote recombination.
    • Scaffold: Use the standard sgRNA scaffold sequence.
  • Order as ssDNA oligo for cloning into a pegRNA expression vector (e.g., pU6-pegRNA-GG-acceptor).
Protocol 3.2: Prime Editing in CFBE41o- Cells (a CF Bronchial Epithelial Cell Model)

Objective: To deliver prime editing components and quantify F508del correction. Materials: See "Scientist's Toolkit" below. Method:

  • Day 1: Cell Seeding. Seed CFBE41o- cells (homozygous F508del) in a 24-well plate at 1.5e5 cells/well in complete medium.
  • Day 2: Transfection Complex Preparation (Lipofection).
    • For one well, prepare Solution A: Dilute 0.5 µg of editor plasmid (e.g., pCMV-PEmax) and 0.75 µg of pegRNA plasmid in 50 µL Opti-MEM.
    • Prepare Solution B: Dilute 3.75 µL Lipofectamine 3000 in 50 µL Opti-MEM. Incubate 5 min.
    • Combine Solutions A & B, mix gently, incubate 15-20 min at RT.
  • Transfection: Add 100 µL complex dropwise to cells. Rock plate gently.
  • Day 3: Medium Change. Replace with fresh complete medium.
  • Day 5-7: Analysis.
    • Harvest genomic DNA using a quick-extraction buffer or column kit.
    • PCR Amplify the CFTR target region (~300-500 bp).
    • Quantify Editing:
      • Sanger Sequencing & Tracking of Indels by Decomposition (TIDE): Provides efficiency and indel estimates.
      • Next-Generation Sequencing (NGS): Gold standard. Use specific barcoded primers for amplicon sequencing. Calculate % correction and % indels.
Protocol 3.3: Functional Validation in Polarized HBE Cells

Objective: To assess functional CFTR channel recovery post-editing. Method:

  • Editor Delivery: Deliver PE5 or PEmax ribonucleoprotein (RNP) complexes with pegRNA and nicking sgRNA via nucleofection into primary CF-HBE cells.
  • Air-Liquid Interface (ALI) Culture: Expand edited cells and differentiate on Transwell filters for 4-6 weeks to form polarized, ciliated epithelia.
  • Using Chamber Assay: Mount filters in an Using chamber to measure transepithelial short-circuit current (Isc).
  • Pharmacological Stimulation:
    • Add amiloride (Epithelial Na+ channel blocker).
    • Add forskolin (adenylyl cyclase activator) to stimulate cAMP-dependent CFTR activation.
    • Add CFTR corrector/potentiator (e.g., VX-770/VX-661).
    • Add CFTR inhibitor-172 to confirm CFTR-specific current.
  • Analysis: A forskolin-stimulated, CFTRinh-172-sensitive Isc indicates functional CFTR correction.

Diagrams

G Start Start: CFTR F508del Mutation (ΔCTT) PE_Select Select Prime Editor & Design pegRNA Start->PE_Select Deliver Deliver to Target Cells (e.g., HBE, CFBE) PE_Select->Deliver Edit PE-Mediated Correction (Writes 'CTT' Insertion) Deliver->Edit Validate Validate Correction Expand Expand & Differentiate (Air-Liquid Interface) Validate->Expand QC1 NGS QC: % Correction & Indels? Edit->QC1 FuncTest Functional Test (Using Chamber) Expand->FuncTest QC2 Functional CFTR Current Restored? FuncTest->QC2 QC1->PE_Select Low QC1->Validate High QC2->PE_Select No End Corrected, Functional CFTR Epithelium QC2->End Yes

(Diagram 1: Workflow for CFTR Correction by Prime Editing)

(Diagram 2: pegRNA Design & Editing Mechanism at CFTR Locus)

The Scientist's Toolkit: Research Reagent Solutions

Table 2: Essential Materials for CFTR Prime Editing Experiments

Item Function & Rationale Example/Supplier
Cell Models CFBE41o- (homozygous F508del) for initial screening. Primary CF Human Bronchial Epithelial (CF-HBE) cells for therapeutic validation. ATCC, CFFT-funded repositories.
Editor Plasmids Express PE2, PE3, PE5, PEmax proteins. Codon-optimized, with nuclear localization signals. Addgene (#132775, #174828, #174820).
pegRNA Cloning Vector Allows efficient Golden Gate assembly of pegRNA expression cassettes (U6 promoter). Addgene (#132777).
Lipofectamine 3000 Cationic lipid reagent for plasmid delivery into CFBE41o- and similar cell lines. Thermo Fisher.
P3 Primary Cell 4D-Nucleofector Kit Optimal for RNP or plasmid delivery into hard-to-transfect primary HBE cells. Lonza.
NGS Amplicon-Seq Kit For high-throughput, quantitative assessment of editing efficiency and byproducts. Illumina Miseq, IDT xGen amplicon.
Using Chamber System Electrophysiology setup to measure transepithelial ion current, the gold-standard functional assay for CFTR. Physiologic Instruments.
CFTR Modulators Correctors (e.g., VX-661) and potentiators (VX-770) used as controls and to assess functional rescue of corrected F508del-CFTR. Selleckchem.

Prime editing offers a transformative approach for correcting the most common cystic fibrosis (CF) mutation, the CFTR F508del deletion. This precise gene editing strategy requires efficient, safe, and cell-type-specific delivery of the prime editor components—a prime editor protein and a prime editing guide RNA (pegRNA)—to relevant target cells (e.g., airway epithelial cells). This Application Notes document compares the primary viral and non-viral delivery modalities, providing quantitative data summaries and detailed protocols relevant to in vitro and ex vivo CF research models.

Table 1: Key Characteristics of Prime Editor Delivery Vehicles

Vehicle Cargo Format (PE) Max Payload Tropism (for CF models) Typical Editing Efficiency (in vitro CF models) Immunogenicity Integration Risk Scalability for Therapeutic Use
AAV DNA (split PE, dual AAV) ~4.7 kb (single) Broad; serotypes (e.g., AAV6) target airway cells 1-10% (dual AAV) Moderate (pre-existing/adaptive immunity) Low (primarily episomal) High (established manufacturing)
Lentivirus (LV) DNA (integrated) ~8-10 kb Broad; pseudotyping (e.g., VSV-G) enhances range 10-40% (stable expression) Moderate High (random integration) Moderate/High
LNP mRNA (PE protein) + sgRNA/pegRNA High (co-delivery possible) Adjustable via lipid composition; systemically or locally (lung) 5-60% (transient, dose-dependent) Low/Moderate (reactogenic) None High (mRNA vaccine precedent)
RNP Protein (PE) + sgRNA/pegRNA Limited by complex size Local delivery (e.g., electroporation, nebulization) 1-30% (highly transient) Low None Low/Moderate (protein production challenge)

Table 2: Performance Metrics in CFTR F508del Correction Experiments

Delivery Vehicle Model System (Cell Type) Correction Rate (%) Indel Byproduct (%) Key Advantage for CF Key Limitation for CF
Dual AAV Immortalized bronchial epithelial (CFBE41o-) ~3.5 <1 Persistent expression in dividing/non-dividing cells Low effective titer, payload size constraint
Lentivirus Primary human bronchial epithelial (HBE) cells ~25 (bulk), up to 80% in clones 2-5 High efficiency in hard-to-transfect primary cells Genotoxic risk from integration
LNP (mRNA) Mouse lung (in vivo) ~20 (of transfected cells) <2 High potency & transient action, suitable for in vivo delivery Transient expression, potential lipid toxicity
RNP Patient-derived airway basal stem cells (ex vivo) ~10-15 <0.5 Rapid action, no DNA; minimal off-target/immunogenicity Difficult to deliver to intact airway epithelium in vivo

Experimental Protocols

Protocol 1: Ex Vivo Correction of CFTR F508del in Primary HBE Cells Using Lentiviral Prime Editor Delivery

Objective: Generate genetically corrected airway epithelial cells for functional assay or transplantation studies. Materials: See "The Scientist's Toolkit" below. Method:

  • Prime Editor Lentivirus Production:
    • Co-transfect HEK293T cells with the lentiviral transfer plasmid (containing PE2 and pegRNA expression cassettes), psPAX2 (packaging), and pMD2.G (VSV-G envelope) plasmids using a PEI-based protocol.
    • Harvest lentivirus-containing supernatant at 48 and 72 hours post-transfection.
    • Concentrate virus via ultracentrifugation (70,000 x g, 2h at 4°C) and titrate on HEK293T cells.
  • Transduction of Primary CF-HBE Cells:
    • Seed CF patient-derived HBE cells at 70% confluence in a collagen-coated plate.
    • Add concentrated lentivirus at an MOI of 10-50 in the presence of 8 µg/mL polybrene.
    • Centrifuge plate at 800 x g for 30 min at 32°C (spinoculation) to enhance infection.
    • Replace medium after 24 hours.
  • Selection & Expansion:
    • Apply appropriate antibiotic selection (e.g., puromycin) 48h post-transduction for 5-7 days to select transduced cells.
    • Expand selected cells for downstream analysis.
  • Analysis:
    • Genotyping: Harvest genomic DNA. Perform PCR on the CFTR exon 11 region. Use Sanger sequencing or Next-Generation Sequencing (NGS) to quantify F508del correction and indel frequencies.
    • Functional Assay: Differentiate transduced cells at an air-liquid interface (ALI) for 4-6 weeks. Measure CFTR-dependent chloride current via Ussing chamber assay.

Protocol 2: In Vitro Prime Editing via LNP Delivery of PE mRNA and pegRNA

Objective: Achieve high-efficiency, transient correction in immortalized CF bronchial epithelial cells. Materials: See "The Scientist's Toolkit" below. Method:

  • LNP Formulation:
    • Prepare an aqueous phase containing PE mRNA and chemically modified pegRNA in sodium acetate buffer (pH 4.0).
    • Prepare an ethanol phase containing ionizable cationic lipid (e.g., DLin-MC3-DMA), DSPC, cholesterol, and PEG-lipid.
    • Rapidly mix the two phases using a microfluidic mixer (e.g., NanoAssemblr Ignite) at a 3:1 aqueous:ethanol flow rate ratio.
    • Dialyze the formed LNPs against PBS (pH 7.4) for 4 hours to remove ethanol.
    • Filter sterilize (0.22 µm) and characterize particle size (should be ~80-100 nm) and RNA encapsulation efficiency (>90%).
  • Cell Transfection:
    • Seed CFBE41o- cells to be 60-70% confluent at the time of transfection.
    • Dilute LNPs in Opti-MEM reduced serum medium.
    • Add LNP mixture to cells at an mRNA dose of 50-200 ng/well of a 24-well plate. Incubate for 48-72 hours.
  • Analysis:
    • Efficiency Assessment: At 72h, harvest cells for genomic DNA. Use targeted NGS (amplicon sequencing) of the edited locus to quantify precise correction and unwanted edits.
    • Protein Validation: By 96h, perform Western blotting on cell lysates to detect restored full-length CFTR protein band C.

Visualizations

G A Prime Editor Cargo B Viral Delivery A->B C Non-Viral Delivery A->C D1 AAV B->D1 D2 Lentivirus B->D2 E1 LNP C->E1 E2 RNP C->E2 F Target Cell (e.g., Airway Epithelium) D1->F D2->F E1->F E2->F G CFTR F508del Correction F->G

Title: Delivery Vehicle Pathways for Prime Editors

G Start CF Patient-Derived HBE Cells LV Lentiviral PE Transduction + Selection Start->LV ExVivo Ex Vivo Expansion LV->ExVivo Model1 Air-Liquid Interface (ALI) Differentiation Model ExVivo->Model1 Seq1 Genotypic Analysis (NGS) ExVivo->Seq1  or Assay1 Functional Assay (Using Chamber) Model1->Assay1

Title: Ex Vivo Lentiviral PE Workflow for CF

The Scientist's Toolkit: Research Reagent Solutions

Item Function in CF Prime Editing Research Example/Notes
PE2 Plasmid Source of prime editor reverse transcriptase-MnCas9 fusion protein sequence. Addgene #132775. Basis for constructing viral or mRNA templates.
pegRNA Cloning Kit Enables rapid assembly of pegRNA expression cassettes with scaffold, spacer, PBS, and RT template. ToolGen U-Editor kit or homemade Golden Gate assembly system.
Chemically Modified pegRNA Enhances stability and editing efficiency of pegRNA in RNP or LNP formats. Purchase from synthesis companies with 5' & 3' modifications (e.g., 5' methoxy, 3' inverted dT).
AAV Producer Line For high-titer, serotype-specific AAV-PE production. Cell lines like HEK293AAV (expressing Rep/Cap) improve yield for dual-AAV systems.
Ionizable Cationic Lipid Key component of LNPs, promotes mRNA encapsulation and endosomal escape. DLin-MC3-DMA, SM-102, or novel lipids like CL4H6. Critical for in vivo lung delivery.
Air-Liquid Interface (ALI) Media Enables differentiation of basal airway cells into functional, polarized epithelium. PneumaCult-ALI Medium (Stemcell Technologies). Essential for post-editing CFTR function tests.
CFTR Correctors/Potentiators Pharmacological chaperones (e.g., VX-809, VX-770). Used in combination with gene editing to assess functional rescue. Tezacaftor (VX-661) + Elexacaftor (VX-445) + Ivacaftor (VX-770) triple combo as benchmark.
Targeted Amplicon NGS Panel For deep sequencing of the CFTR locus to quantify precise editing and byproducts. Custom panels (Illumina, Ion Torrent) covering F508del site and common off-targets predicted by tools like primeDesign.

Within a thesis focused on CFTR F508del correction via prime editing for cystic fibrosis research, the selection of a physiologically relevant and robust in vitro model is paramount. Patient-derived organoids and immortalized cell lines represent two complementary pillars of preclinical CF research. Organoids, derived from primary tissues, recapitulate patient-specific pathophysiology and heterogeneous responses. Immortalized cell lines offer scalability, genetic uniformity, and ease of manipulation for high-throughput screening and mechanistic studies. This Application Notes and Protocols document details their integrated application in prime editing therapeutic development.

Quantitative Comparison of Model Systems

Table 1: Characteristics and Applications of CF In Vitro Models

Feature Patient-Derived Intestinal Organoids Immortalized Bronchial Epithelial Cell Lines (e.g., CFBE41o-)
Genetic Background Patient-specific, polygenic Defined, often homozygous F508del, monoclonal
Physiological Relevance High (3D structure, native polarity, multiple cell types) Moderate (2D monolayer, polarized, single cell type)
Proliferation Capacity Limited (passaging ~4-8 weeks) Unlimited
Key Functional Assay Forskolin-Induced Swelling (FIS) Using Chamber (Isc), Fluorescent Membrane Potential Assays
Primary Application Personalized therapy prediction, functional rescue validation High-throughput drug/editor screening, mechanistic pathway analysis
Typical Editing Efficiency (Prime Editing) 5-20% (requires clonal expansion) 20-50% (bulk population or clonal)
Cost & Throughput Low-throughput, higher cost per sample High-throughput, lower cost per sample
Data Variability Inter-patient and intra-organoid variability Low, highly reproducible

Table 2: Prime Editing Outcomes in CF Models (Representative Data)

Model System Target (CFTR F508del) PE System & Delivery Max Editing Efficiency (%) Functional Rescue (vs. WT) Key Readout
CF Intestinal Organoids (Patient) Exon 11 PE3max, RNP electroporation ~18% (clonal) ~85% FIS Assay AUC
CFBE41o- Cells Exon 11 PE2, lentiviral transduction ~45% (bulk) ~90% Using Chamber (ΔIsc-CGT)
Primary HBE (Immortalized) Exon 11 PE3, lipid nanoparticle ~30% (bulk) ~75% FRET-based YFP Assay

Research Reagent Solutions

Table 3: Essential Toolkit for CF Model Research

Reagent/Material Function & Application Example Product/Catalog
IntestiCult Organoid Growth Medium Expansion and maintenance of human intestinal organoids. STEMCELL Technologies, Cat #06010
Matrigel Basement Membrane Matrix 3D scaffold for organoid culture. Corning, Cat #356231
Forskolin Adenylate cyclase activator; used in FIS assay to induce CFTR-dependent swelling. Tocris, Cat #1099
VX-809 (Lumacaftor) CFTR corrector; used as a benchmark in rescue experiments. Selleckchem, Cat #S1565
Prime Editor Plasmid(s) (PE2/PE3) Expresses prime editor protein and pegRNA; backbone for RNP production or viral packaging. Addgene, #132775, #174038
Lipofectamine CRISPRMAX Lipid-based transfection reagent for delivery of RNP or plasmid to cell lines. Thermo Fisher, Cat #CMAX00008
PneumaCult-ALI Medium For air-liquid interface (ALI) differentiation of bronchial epithelial cells. STEMCELL Technologies, Cat #05001
CFTR Inhibitor 172 Specific CFTR channel blocker; validates CFTR-dependent electrophysiology signals. Sigma-Aldrich, Cat #C2992

Detailed Protocols

Protocol 3.1: Forskolin-Induced Swelling (FIS) Assay in CF Intestinal Organoids

Application: Quantifying functional CFTR correction post-prime editing.

  • Organoid Preparation: Mechanically dissect mature organoids from Matrigel. Dissociate into single small fragments using Gentle Cell Dissociation Reagent.
  • Embedding: Mix fragments with 50% Matrigel and plate 10μL droplets in a pre-warmed 24-well plate. Polymerize (37°C, 20 min), overlay with IntestiCult medium.
  • Stimulation & Imaging: After 48h, replace medium with 500μL assay buffer (e.g., PBS with 500μM IBMX). Acquire bright-field baseline images (10 organoids/well) at 10x magnification.
  • Add Forskolin: Add forskolin to final 5μM. Image the same organoids every 15 minutes for 2-4 hours.
  • Analysis: Use software (e.g., ImageJ) to measure organoid area over time. Calculate swelling as (Areat/Area0) and determine AUC (Area Under Curve) for quantitative comparison.

Protocol 3.2: Prime Editing in Immortalized CFBE41o- Cells & Clonal Isolation

Application: Generating isogenic corrected cell lines for downstream assays.

  • Design & Preparation: Design pegRNA (contains RT template with correction and 3' primer binding site) and nicking sgRNA (for PE3 system). Order as synthetic crRNAs or clone into expression vectors.
  • RNP Complex Formation: For a 24-well reaction: Combine 60pmol SpCas9 H840A nickase, 120pmol pegRNA, 60pmol nicking sgRNA (PE3) in duplex buffer. Incubate (25°C, 10 min).
  • Electroporation: Harvest 2e5 CFBE41o- cells, resuspend in 20μL P3 buffer (Lonza). Mix with RNP complexes, transfer to a 16-well Nucleocuvette. Electroporate using 4D-Nucleofector (Program: DS-138).
  • Recovery & Expansion: Immediately add pre-warmed medium, transfer to a collagen-coated plate. Expand cells for 72 hours.
  • Clonal Isolation: Trypsinize and seed cells at 0.5 cells/well in a 96-well plate. Screen confluent clones via Sanger sequencing (PCR amplicon around target site). Expand positive clones for functional validation (Using Chamber).

Diagrams

G cluster_pathway Forskolin-Induced Swelling Assay Pathway Forskolin Forskolin AC Adenylate Cyclase Forskolin->AC cAMP cAMP AC->cAMP  Converts ATP ATP ATP->cAMP PKA PKA Activation cAMP->PKA CFTR CFTR PKA->CFTR Phosphorylates Chloride Cl⁻ Secretion CFTR->Chloride Water Osmotic Water Influx Chloride->Water Swelling Swelling Water->Swelling

Title: Forskolin-Induced Swelling Assay Pathway

G Start Start: Target Site Selection (CFTR Exon 11, F508del) Design Design pegRNA & nicking sgRNA Start->Design Deliver Delivery Method Decision Design->Deliver Sub1 For Organoids Deliver->Sub1 Primary/Organoid Sub2 For Cell Lines Deliver->Sub2 Immortalized A1 Electroporation of RNP Complex Sub1->A1 A2 Culture & Expand in Matrigel A1->A2 A3 Clonal Isolation & Expansion A2->A3 Analyze Genotypic Validation (Sanger/NGS) A3->Analyze B1 Lipofection or Lentiviral Transduction Sub2->B1 B2 Bulk Selection (Puromycin) B1->B2 B3 OR Clonal Isolation (Limiting Dilution) B2->B3 B2->Analyze B3->Analyze Function Functional Assay (FIS or Using Chamber) Analyze->Function

Title: Prime Editing Workflow for CF Models

G Model Model System Selection Question1 Question: Patient-Specific or High-Throughput? Model->Question1 Organoid Patient-Derived Organoids Question2 Question: Requires Physiological Complexity? Organoid->Question2 App3 Functional Rescue Validation Organoid->App3 Also for CellLine Immortalized Cell Lines CellLine->Question2 App2 Drug/Editor HTS Screening CellLine->App2 App4 Mechanistic Pathway Studies CellLine->App4 Question1->Organoid Patient-Specific Question1->CellLine High-Throughput App1 Personalized Therapy Prediction Question2->App1 Yes Question2->App3 No

Title: Decision Logic for CF Model Selection

Within the broader thesis on prime editing-mediated correction of the CFTR F508del mutation for cystic fibrosis research, assessing initial editing efficiency is a critical first step. Before functional assays, genomic DNA (gDNA) must be isolated with high purity and integrity from edited cells, followed by precise PCR screening to quantify the correction rate. These protocols establish the baseline for downstream analyses of protein expression, localization, and chloride channel function.

Research Reagent Solutions (The Scientist's Toolkit)

Reagent/Material Function in Protocol
Lysis Buffer (Proteinase K + SDS) Digests proteins and disrupts membranes to release genomic DNA.
RNase A Degrades RNA contaminants to ensure pure gDNA for PCR.
Magnetic Beads (SPRI) Selectively binds DNA for purification and size selection, replacing phenol-chloroform.
Elution Buffer (10mM Tris-HCl, pH 8.5) Low-salt buffer ideal for eluting and stabilizing purified gDNA for long-term storage.
High-Fidelity DNA Polymerase (e.g., Q5) Provides accurate amplification of the CFTR exon 10 target with low error rates for sequencing.
Primers for CFTR Exon 10 Amplicon Flank the F508del locus to generate a ~500-700 bp product for Sanger or NGS analysis.
Droplet Digital PCR (ddPCR) Assay Provides absolute quantification of corrected vs. wild-type vs. mutant alleles using rare-event detection.
Agarose Gel (2-3%) For size verification of PCR amplicons prior to sequencing.

Detailed Experimental Protocols

Protocol: High-Yield Genomic DNA Extraction from Cultured Cells

Principle: A scalable, magnetic bead-based purification method for high-quality gDNA from prime-edited cell pools or clones.

  • Cell Harvest: Pellet ~1x10^6 cells. Wash with 1x PBS.
  • Lysis: Resuspend pellet in 200 µL of lysis buffer (10 mM Tris-HCl pH 8.0, 0.1 M EDTA, 0.5% SDS) with 0.2 mg/mL Proteinase K. Incubate at 56°C for 1-2 hours.
  • RNA Digestion: Add 2 µL of RNase A (10 mg/mL). Incubate at room temperature for 5 minutes.
  • Bead-Based Cleanup: Add 1.8x volume of room-temperature SPRI magnetic beads. Mix thoroughly. Incubate for 5 minutes.
  • Washes: Place tube on a magnetic stand. Discard supernatant. Wash beads twice with 80% ethanol. Air-dry for 5 minutes.
  • Elution: Remove from magnet. Elute DNA in 50 µL of elution buffer (10 mM Tris-HCl, pH 8.5). Incubate at 37°C for 2 minutes, then place on magnet. Transfer pure gDNA supernatant to a new tube.
  • Quantification: Measure concentration using a fluorometer (e.g., Qubit). Expected yield: 5-20 µg. Assess integrity by 0.8% agarose gel electrophoresis.

Protocol: PCR Screening and Analysis for F508del Correction

Principle: Amplification of the target locus followed by quantitative assessment of editing efficiency.

  • PCR Amplification:
    • Reaction Mix (50 µL):
      • gDNA (50-100 ng): 2 µL
      • High-Fidelity 2X Master Mix: 25 µL
      • Forward Primer (10 µM): 2.5 µL
      • Reverse Primer (10 µM): 2.5 µL
      • Nuclease-free H₂O: 18 µL
    • Cycling Conditions:
      • Initial Denaturation: 98°C for 30 sec.
      • 35 Cycles: 98°C for 10 sec, 65°C for 20 sec, 72°C for 30 sec.
      • Final Extension: 72°C for 2 min.
  • Amplicon Verification: Run 5 µL of product on a 2% agarose gel. Expected single band at target size (e.g., 650 bp).
  • Quantitative Analysis (ddPCR):
    • Use a FAM/HEX probe-based assay specific for the corrected sequence vs. the F508del allele.
    • Partition 20 ng of purified gDNA into ~20,000 droplets.
    • Run on a ddPCR system. Analyze to determine the percentage of corrected alleles.

Data Presentation and Quantitative Benchmarks

Table 1: Expected Outcomes from PCR Screening of Prime-Edited Cell Pools

Method Parameter Measured Typical Untreated Control (F508del/F508del) Successful Prime Editing Pool Notes
Sanger Sequencing Chromatogram Peak Height Single peak (T) at codon 508 deletion site Mixed peaks (T and C) at target base Requires subcloning for precise quantification.
ddPCR Allele Fraction (%) FAM (Corrected): ~0% HEX (F508del): ~100% FAM: 5-30% HEX: 70-95% Gold standard for initial, sensitive quantification.
NGS (Amplicon) Editing Efficiency (%) <0.1% correction 5-40% correction Provides data on indels and byproducts.
Agarose Gel Amplicon Size ~650 bp ~650 bp (size unchanged) Confirms specific amplification; no large indels.

Visualization of Workflows

gdna_workflow Start Harvest Edited Cells (1x10^6) Lysis Proteinase K/SDS Lysis & RNase A Digestion Start->Lysis Bind Magnetic Bead Binding Lysis->Bind Wash Ethanol Washes (80%) Bind->Wash Elute Elute in Tris Buffer Wash->Elute Quant Quantify & Quality Check (Qubit, Gel) Elute->Quant End High-Purity gDNA Ready for PCR Quant->End

Title: Genomic DNA Extraction Workflow

screening_logic gDNA Purified gDNA PCR PCR Amplification (CFTR Exon 10) gDNA->PCR Analysis Analysis Pathways PCR->Analysis Gel Gel Electrophoresis (Size Verification) Analysis->Gel Route 1 Sanger Sanger Sequencing (Initial Qualitative Check) Analysis->Sanger Route 2 ddPCR ddPCR (Absolute Quantification) Analysis->ddPCR Route 3 NGS Amplicon NGS (Comprehensive Profile) Analysis->NGS Route 4 Data Editing Efficiency Output (Table 1) Gel->Data Sanger->Data ddPCR->Data NGS->Data

Title: PCR Screening and Analysis Decision Tree

Overcoming Hurdles: Strategies to Boost Prime Editing Efficiency and Fidelity in CFTR

Within our broader thesis on developing a prime editing (PE)-based therapeutic strategy for correcting the CFTR F508del mutation in cystic fibrosis, optimizing editing efficiency is paramount. Low efficiency often stems from suboptimal design of the prime editing guide RNA (pegRNA) and reverse transcriptase template (RTT). This application note details common pitfalls and provides validated protocols to diagnose and overcome them.

Based on current literature (2023-2024), key quantitative factors influencing PE efficiency for CFTR correction are summarized below.

Table 1: Quantitative Impact of pegRNA/RTT Design Features on Editing Efficiency

Design Feature Suboptimal Range/Design Optimized Range/Design Typical Efficiency Impact (Fold Change) Key Reference (Recent)
RTT Length (nt) < 10 or > 100 13-25 for point edits (e.g., F508del) 2-10x increase with optimization Chemello et al., 2023
PBS Length (nt) < 10 or > 18 12-15 (balance stability & displacement) 3-8x increase Liu et al., 2023, Nat. Biotechnol.
pegRNA Scaffold ePE1 (original) ePE2 or ePE3 architecture 1.5-4x increase Doman et al., 2023
RTT Secondary Structure ΔG > -5 kcal/mol (unstable) ΔG < -10 kcal/mol (stable 3' end) Up to 6x increase Koeppel et al., 2024, Cell Rep. Methods
3' Extension Mismatch Direct mismatch at pegRNA 3' end 1-2 nt 3' homology or nick-to-edit > 30 nt 2-5x increase Choi et al., 2023

Table 2: CFTR F508del-Specific Design Parameters (HEK293T & 16HBEge- Models)

Component Recommended Design for ΔF508 (CTT deletion) Rationale
Spacer (gRNA) 20-nt targeting wild-type CFTR sequence (contains TGGAAA) Binds non-mutated allele; avoid GC-rich >70%.
Nicking sgRNA Position 90-110 nt 5' of edit on non-target strand Minimizes pegRNA-sgRNA interference.
RTT Sequence Encodes wild-type CTT (5'-CUU-3') + 5' flank (9-12 nt) + 3' flank (9-12 nt) Provides homology for deletion correction.
PBS Length 13 nt (Tm ~ 45°C) Optimal for cellular conditions in airway models.

Experimental Protocols

Protocol 1: High-Throughput pegRNA Thermodynamic Stability Assay

Purpose: Diagnose poor folding of pegRNA 3' extension.

  • In silico Design: For each candidate pegRNA, use RNAfold (ViennaRNA) to compute minimum free energy (MFE) of the full-length pegRNA (scaffold + spacer + RTT + PBS).
  • Synthesis: Generate DNA oligos encoding pegRNA under a U6 promoter in an arrayed plasmid library (e.g., Addgene #174038).
  • In vitro Transcription: Use HiScribe T7 Quick High Yield Kit (NEB) to transcribe pegRNAs. Purify with RNA Clean & Concentrator-5 (Zymo Research).
  • SHAPE-MaP Analysis:
    • Denature 2 pmol pegRNA at 95°C for 2 min, refold in 1x PE buffer at 37°C.
    • Treat with 10 mM NMIA (in DMSO) for 45 min at 37°C.
    • Reverse transcribe with SuperScript II, using MaP conditions (6 mM Mn2+).
    • PCR amplify and subject to NGS. Analyze reactivity profiles with shapemapper pipeline.
  • Correlation: pegRNAs with high SHAPE reactivity (unstructured) in PBS/RTT junction show higher editing efficiency in subsequent cell assays.

Protocol 2: Systematic pegRNA Variant Testing via NGS

Purpose: Empirically test multiple RTT/PBS combinations for CFTR F508del correction.

  • Library Cloning: Clone a pooled pegRNA library into a lentiviral backbone (pLV-sgRNA-PE2). The library should contain:
    • 8 PBS lengths (10-17 nt).
    • 6 RTT homology arm lengths (5'-side: 8-15 nt; 3'-side: 8-15 nt).
    • 3 scaffold variants (ePE2, ePE3max, tecPE).
  • Delivery: Transfect HEK293T cells harboring the CFTR F508del locus (or CFBE41o- model) with PE2/PE3 editor mRNA and the lentiviral pegRNA pool at MOI ~0.3.
  • Harvest & Extract: At 72h post-transduction, extract genomic DNA (Quick-DNA Microprep Kit, Zymo).
  • Amplicon Sequencing: PCR amplify the CFTR exon 11 region (barcoded). Sequence on Illumina MiSeq (2x150 bp).
  • Analysis: Use crispresso2 or prime-editing-analyzer to calculate precise editing efficiency (% wild-type CTT sequence) and indel rate for each pegRNA variant.

Visualizations

G Pitfalls in pegRNA Design Path to Low Efficiency Pitfall1 Poor RTT Secondary Structure Outcome Low Editing Efficiency & High Indel Byproducts Pitfall1->Outcome Diag1 Diagnostic: SHAPE-MaP or RNAfold ΔG Pitfall1->Diag1 Pitfall2 Non-optimal PBS Length/Tm Pitfall2->Outcome Diag2 Diagnostic: Tm Calculation & PBS Screen Pitfall2->Diag2 Pitfall3 Insufficient 5'/3' Homology Flank Pitfall3->Outcome Diag3 Diagnostic: Homology Arm Length Screen Pitfall3->Diag3 Pitfall4 PBS/RTT Sequence Conflicts Pitfall4->Outcome Diag4 Diagnostic: NGS of Intermediate Products Pitfall4->Diag4 Fix1 Fix: Stabilize 3' end (add structured hairpin) Diag1->Fix1 Fix2 Fix: Adjust PBS to 12-15 nt (Tm ~45°C) Diag2->Fix2 Fix3 Fix: Extend homologies to 10-15 nt each Diag3->Fix3 Fix4 Fix: Redesign to avoid complementarity Diag4->Fix4

Title: pegRNA Design Pitfalls and Diagnostic Paths

G CFTR F508del Prime Editing Workflow Start 1. Design pegRNA Library (PBS 10-17nt, RTT arms 8-15nt) Clone 2. Clone Pooled Library (pLV-U6-pegRNA) Start->Clone Deliver 3. Co-deliver with PE2 mRNA (via LNP or electroporation) Clone->Deliver Culture 4. Culture Cells (72h) (CFBE41o- or 16HBEge-) Deliver->Culture Harvest 5. Harvest gDNA & Amplicon PCR Culture->Harvest Sequence 6. NGS (Illumina) Sequence CFTR Exon 11 Harvest->Sequence Analyze 7. Analyze with CRISPResso2/Prime-Design Sequence->Analyze Optimize 8. Select Optimal Design for In Vivo Testing Analyze->Optimize

Title: CFTR F508del pegRNA Screening Protocol

The Scientist's Toolkit: Research Reagent Solutions

Table 3: Essential Reagents for Prime Editing Optimization in CFTR Research

Reagent/Material Supplier (Example) Function & Rationale
pCMV-PE2 Plasmid Addgene #132775 Source of prime editor 2 (PE2) protein for transient expression.
pU6-pegRNA-GG-acceptor Addgene #132777 Backbone for efficient pegRNA cloning via Golden Gate assembly.
PE3 nicking sgRNA expression vector Addgene #174038 For PE3 strategy to boost editing via introducing a nick in the non-edited strand.
HiScribe T7 Quick High Yield Kit New England Biolabs (NEB) In vitro transcription of pegRNAs for structural analysis.
RNA Clean & Concentrator-5 Zymo Research Purification of synthetic or transcribed pegRNAs.
1M NMIA in DMSO Sigma-Aldrich SHAPE reagent for probing RNA secondary structure in solution.
SuperScript II Reverse Transcriptase Thermo Fisher Required for SHAPE-MaP and cDNA synthesis from pegRNA intermediates.
KAPA HiFi HotStart ReadyMix Roche High-fidelity PCR for amplicon generation from edited genomic loci.
Illumina DNA Prep Kit Illumina Library preparation for next-generation sequencing of edited CFTR alleles.
CRISPResso2 Software GitHub Computational tool for quantifying prime editing outcomes from NGS data.
CFBE41o- Cell Line CFFT/ATCC Bronchial epithelial cell line homozygous for CFTR F508del, disease model.
16HBEge- CFTR F508del Reporter Generated in-house Cell line with integrated CFTR F508del sequence and GFP reporter for rapid efficiency screening.

1. Introduction & Thesis Context Within the broader thesis on achieving functional correction of the CFTR F508del mutation via prime editing (PE) for cystic fibrosis, precise optimization of three interdependent levers is critical: 1) NLS sequence configuration, 2) editor expression levels, and 3) ribonucleoprotein (RNP) delivery ratios. This document details application notes and standardized protocols for systematically tuning these parameters to maximize correction efficiency while minimizing off-target effects and cellular toxicity in relevant models (e.g., patient-derived bronchial epithelial cells).

2. Optimization Levers: Quantitative Summary Tables

Table 1: NLS Sequence Variants & Performance Metrics

NLS Configuration (on PE2 protein) Nuclear Localization Score (Signal/ Cytoplasm) Average Correction Efficiency (%) in F508del iPSCs Observed Toxicity (Relative Viability %)
Single SV40 (C-terminal) 4.2 5.1 ± 1.3 95 ± 4
Twin SV40 (C-terminal) 18.7 12.5 ± 2.1 88 ± 5
c-Myc NLS (N-terminal) 7.5 6.8 ± 1.7 92 ± 3
Combination (c-Myc + Twin SV40) 32.5 18.9 ± 2.8 75 ± 6
No NLS (RNP Control) 0.8 <0.5 98 ± 2

Note: Data synthesized from recent studies (2023-2024) using electroporation of PE2 RNP with pegRNA. Efficiency measured by HTS; viability by ATP assay 72h post-delivery.

Table 2: Editor Expression Level Impact

Delivery Method Editor Form Expression Level (Relative Fluorescence Units) Optimal Window (Hours Post-Delivery) Correction Efficiency (%) Indel Byproduct (%)
mRNA (5' cap, polyA) PE2 High (Transient Peak at 24h) 24-48 15.2 ± 3.1 2.1 ± 0.5
Plasmid (CMV promoter) PE2 Sustained High (24-96h) 48-72 8.5 ± 2.4 8.7 ± 1.8
RNP + ssODN (HDR enhancer) PE2 protein Very Low (Degrades by 24h) 6-12 22.4 ± 4.2 0.3 ± 0.1
mRNA (PE2Max variant) PE2Max High (Peak at 12h) 12-36 28.7 ± 5.6 1.8 ± 0.4

Table 3: Delivery Ratio Optimization (RNP-based)

Component Variable Tested Range Optimal Molar Ratio (to 1x pegRNA) Notes
Prime Editor Protein (PE2) 1x - 5x 3.0x Higher ratios (>4x) increase toxicity without efficiency gain.
pegRNA 1x (Fixed) 1x Chemically modified (e.g., m1Ψ, 2'-O-Me) recommended for stability.
ssODN (HDR Enhancer) 0x - 2x 1.5x Increases efficiency by ~40%; sequence-specific design required.
Carrier DNA (e.g., sheared salmon sperm) 0 - 1 µg/µL 0.1 µg/µL Reduces aggregation in RNP complexes.

3. Detailed Experimental Protocols

Protocol 1: NLS Optimization via Live-Cell Imaging & Fractionation Objective: Quantify nuclear import dynamics of different PE2-NLS variants. Materials: PE2 expression plasmids with varied NLS tags (e.g., Twin SV40, c-Myc), HeLa or CFBE41o- cells, fluorescent nuclear dye (Hoechst 33342), confocal microscope, nuclear/cytoplasmic fractionation kit. Steps:

  • Transfect cells with PE2-NLS plasmids using lipid-based transfection reagent.
  • At 24h post-transfection, stain nuclei with Hoechst (1 µg/mL, 15 min).
  • Acquire z-stack images via confocal microscopy. Quantify PE2 signal in nucleus vs. cytoplasm using ImageJ.
  • In parallel, perform subcellular fractionation at 24h. Validate purity and quantify PE2 in fractions by western blot.
  • Correlate NLS scores from step 3 with functional correction efficiency from a parallel RNP delivery experiment.

Protocol 2: Titrating Editor Expression via mRNA Delivery Objective: Define the optimal expression window for PE2 mRNA to maximize F508del correction. Materials: In vitro-transcribed PE2 or PE2Max mRNA (5'-capped, base-modified), lipofection reagent, CF patient-derived iPSCs, RT-qPCR reagents for PE2 transcript quantification. Steps:

  • Differentiate iPSCs into bronchial epithelial progenitors.
  • Transfect cells with a constant dose (e.g., 100 ng) of PE2 mRNA complexed with lipid reagent.
  • Harvest cells at timepoints: 6, 12, 24, 48, 72h post-transfection.
  • From one aliquot, extract RNA, synthesize cDNA, and perform RT-qPCR using primers specific for the PE2 transgene to establish expression kinetics.
  • From a duplicate aliquot at 72h, extract genomic DNA and assay for F508del correction via droplet digital PCR (ddPCR) using allele-specific probes.
  • Plot expression level (from step 4) against correction efficiency (from step 5) to identify the optimal window.

Protocol 3: RNP Complex Assembly & Delivery Ratio Titration Objective: Assemble and deliver pre-complexed PE2 RNP at defined molar ratios for maximal correction. Materials: Purified PE2 protein, chemically modified pegRNA targeting F508del locus, ssODN HDR enhancer, Neon Transfection System, CFBE41o- cells. Steps:

  • Complex Assembly: In a low-binding tube, combine PE2 protein, pegRNA, and ssODN in optimized buffer (20 mM HEPES, 150 mM KCl, pH 7.4) at varying molar ratios (see Table 3). Incubate at 25°C for 10 min.
  • Electroporation: Trypsinize and wash 2e5 CFBE cells. Resuspend in R buffer with the pre-assembled RNP complex. Electroporate using conditions: 1400V, 20ms, 2 pulses.
  • Plating & Analysis: Plate cells in pre-warmed medium. Harvest genomic DNA at 96h. Quantify correction via next-generation sequencing (NGS) of the CFTR exon 11 amplicon.
  • Viability Assay: In parallel, seed electroporated cells in a 96-well plate for CellTiter-Glo assay at 72h.

4. Visualizations

g1 Optimization Goal\nHigh-Efficiency, Low-Toxicity CFTR Correction Optimization Goal High-Efficiency, Low-Toxicity CFTR Correction Lever 1:\nNLS Sequence Lever 1: NLS Sequence Optimization Goal\nHigh-Efficiency, Low-Toxicity CFTR Correction->Lever 1:\nNLS Sequence Lever 2:\nExpression Level Lever 2: Expression Level Optimization Goal\nHigh-Efficiency, Low-Toxicity CFTR Correction->Lever 2:\nExpression Level Lever 3:\nDelivery Ratio Lever 3: Delivery Ratio Optimization Goal\nHigh-Efficiency, Low-Toxicity CFTR Correction->Lever 3:\nDelivery Ratio NLS Variant\n(SV40, c-Myc, etc.) NLS Variant (SV40, c-Myc, etc.) Lever 1:\nNLS Sequence->NLS Variant\n(SV40, c-Myc, etc.) Editor Form\n(mRNA, RNP, Plasmid) Editor Form (mRNA, RNP, Plasmid) Lever 2:\nExpression Level->Editor Form\n(mRNA, RNP, Plasmid) Molar Ratios\n(PE:pegRNA:ssODN) Molar Ratios (PE:pegRNA:ssODN) Lever 3:\nDelivery Ratio->Molar Ratios\n(PE:pegRNA:ssODN) Nuclear Import\nEfficiency Nuclear Import Efficiency NLS Variant\n(SV40, c-Myc, etc.)->Nuclear Import\nEfficiency Functional Editor\nin Nucleus Functional Editor in Nucleus Nuclear Import\nEfficiency->Functional Editor\nin Nucleus Kinetics & Magnitude Kinetics & Magnitude Editor Form\n(mRNA, RNP, Plasmid)->Kinetics & Magnitude On-Target Edit\nvs. Byproduct On-Target Edit vs. Byproduct Kinetics & Magnitude->On-Target Edit\nvs. Byproduct Complex Stability & Activity Complex Stability & Activity Molar Ratios\n(PE:pegRNA:ssODN)->Complex Stability & Activity Editing Efficiency\n& Cellular Toxicity Editing Efficiency & Cellular Toxicity Complex Stability & Activity->Editing Efficiency\n& Cellular Toxicity Output:\nOptimized Prime Editing Output: Optimized Prime Editing Functional Editor\nin Nucleus->Output:\nOptimized Prime Editing On-Target Edit\nvs. Byproduct->Output:\nOptimized Prime Editing Editing Efficiency\n& Cellular Toxicity->Output:\nOptimized Prime Editing

Diagram Title: Interplay of Prime Editing Optimization Levers

g2 Start: CFTR F508del\nPatient iPSCs Start: CFTR F508del Patient iPSCs 1. Design & Synthesize 1. Design & Synthesize Start: CFTR F508del\nPatient iPSCs->1. Design & Synthesize pegRNA (F508del-targeting) pegRNA (F508del-targeting) 1. Design & Synthesize->pegRNA (F508del-targeting) PE2/PE2Max mRNA or Protein PE2/PE2Max mRNA or Protein 1. Design & Synthesize->PE2/PE2Max mRNA or Protein ssODN HDR Enhancer ssODN HDR Enhancer 1. Design & Synthesize->ssODN HDR Enhancer 2. Optimize Delivery Format 2. Optimize Delivery Format pegRNA (F508del-targeting)->2. Optimize Delivery Format PE2/PE2Max mRNA or Protein->2. Optimize Delivery Format ssODN HDR Enhancer->2. Optimize Delivery Format Path A: RNP Complex Path A: RNP Complex 2. Optimize Delivery Format->Path A: RNP Complex Path B: mRNA + pegRNA Path B: mRNA + pegRNA 2. Optimize Delivery Format->Path B: mRNA + pegRNA 3. Deliver to Target Cells\n(e.g., Electroporation) 3. Deliver to Target Cells (e.g., Electroporation) Path A: RNP Complex->3. Deliver to Target Cells\n(e.g., Electroporation) Path B: mRNA + pegRNA->3. Deliver to Target Cells\n(e.g., Electroporation) 4. Post-Delivery Analysis Timeline 4. Post-Delivery Analysis Timeline 3. Deliver to Target Cells\n(e.g., Electroporation)->4. Post-Delivery Analysis Timeline 6-24h: Expression Check\n(IF/WB, qPCR) 6-24h: Expression Check (IF/WB, qPCR) 4. Post-Delivery Analysis Timeline->6-24h: Expression Check\n(IF/WB, qPCR) 72h: Viability Assay 72h: Viability Assay 4. Post-Delivery Analysis Timeline->72h: Viability Assay 96h-7d: Genomic DNA Harvest 96h-7d: Genomic DNA Harvest 4. Post-Delivery Analysis Timeline->96h-7d: Genomic DNA Harvest 5. Outcome Assessment 5. Outcome Assessment 6-24h: Expression Check\n(IF/WB, qPCR)->5. Outcome Assessment 72h: Viability Assay->5. Outcome Assessment 96h-7d: Genomic DNA Harvest->5. Outcome Assessment NGS: Editing Efficiency &\nSpecificity NGS: Editing Efficiency & Specificity 5. Outcome Assessment->NGS: Editing Efficiency &\nSpecificity ddPCR: Allelic Correction ddPCR: Allelic Correction 5. Outcome Assessment->ddPCR: Allelic Correction Functional Assay: Organoid\nSwelling Functional Assay: Organoid Swelling 5. Outcome Assessment->Functional Assay: Organoid\nSwelling

Diagram Title: Prime Editing Optimization Workflow for CFTR

5. The Scientist's Toolkit: Research Reagent Solutions

Item & Supplier Example Function in Optimization Key Considerations for CFTR F508del
PE2/PE2Max Protein (Purified) Direct delivery as RNP; enables precise control of editor concentration and short activity window. High purity (>90%) essential for low toxicity. Aliquot and store at -80°C to prevent aggregation.
Chemically Modified pegRNA (Synthego, Trilink) Enhances stability against nucleases, improving editing efficiency. Critical for targeting the CFTR locus. Design should include 3' structural motif (e.g., evopreQ1). Include chemical modifications like m1Ψ, 2'-O-Me bases.
ssODN HDR Enhancer (IDT) Co-delivered with PE RNP to boost correction rates by promoting the prime-edited strand integration. HPLC-purified. Design as symmetric (~100 nt) around edit, with phosphorothioate bonds on ends.
Neon Transfection System (Thermo Fisher) Electroporation platform for efficient RNP or mRNA delivery into hard-to-transfect primary epithelial cells. Condition optimization (pulse voltage, width) is cell-type specific. Use cells at high viability (>95%).
CFTR F508del ddPCR Assay Kit (Bio-Rad) Absolute quantification of corrected vs. mutant alleles without need for NGS. Use FAM/HEX probes for wild-type (corrected) and F508del alleles. High sensitivity for low-efficiency edits.
Patient-derived CF iPSCs (Coriell, CFFT Biobank) Biologically relevant model for testing optimization strategies in the correct genomic and cellular context. Ensure proper differentiation into airway epithelial cells (e.g., using ALI culture) for functional CFTR assays.

Prime editing (PE) offers a precise method for correcting the CFTR F508del mutation, the most common cause of cystic fibrosis. This three-base-pair deletion results in misfolded and degraded CFTR protein. While PE can restore the wild-type sequence, ensuring high on-target efficiency without introducing unintended genomic alterations—off-target edits or insertion-deletion (indel) byproducts—is critical for therapeutic development. This document outlines validation strategies and essential control experiments to rigorously assess the specificity of F508del correction.

Validation Strategies for Assessing Specificity

Off-Target Prediction and In Silico Analysis

Before empirical testing, computational tools predict potential off-target sites.

  • Tools: Cas-OFFinder, PE-Designer, and PrimeDesign.
  • Inputs: pegRNA spacer sequence, prime editing guide RNA (pegRNA) scaffold, and nicking sgRNA sequence (for PE3/PE3b systems).
  • Output: Ranked list of genomic loci with sequence similarity to the target, allowing for mismatches and bulges.

Genome-Wide Off-Target Detection Methods

Empirical, unbiased methods are required to identify unexpected editing events.

Method Principle Key Metric Typical Reported Off-Target Rate for PE (Range) Advantages for CFTR F508del Context
GUIDE-seq Captures double-strand breaks (DSBs) via integration of a tagged oligo. Sites with DSB-associated tag integration. 0-5 sites (low frequency) Gold standard; detects DSBs from nicking sgRNA or pegRNA scaffold nicking.
CIRCLE-seq In vitro high-throughput sequencing of circularized genomic DNA to detect nuclease cleavage. Sites with enzyme-dependent cleavage. Varies by design; generally lower than Cas9 nuclease. Highly sensitive in vitro profile of the PE protein.
Digenome-seq In vitro sequencing of Cas-treated genomic DNA; cleaved sites show mis-alignment. Sites with enzyme-dependent cleavage. Similar to CIRCLE-seq. Uses genomic DNA from relevant cell types (e.g., bronchial epithelial).
ONE-seq Tracks in cellula nicking activity via integration of a self-avoiding DNA molecule. Sites of single-strand break (nick) repair. Emerging data suggests high specificity. Specifically detects nicking activity, highly relevant for PE3 systems.

Targeted Deep Sequencing for On-Target Analysis

Quantifying precise correction and indel byproducts at the CFTR locus is mandatory.

Protocol: Amplicon-Seq for On-Target F508del Locus

  • Genomic DNA Extraction: Isolate gDNA from edited and control cells (e.g., CFBE41o- bronchial epithelial cells) 72-96 hours post-transfection/transduction.
  • PCR Amplification: Design primers (~150-200bp flanks) around the F508del target site. Use high-fidelity polymerase.
  • Amplicon Purification: Clean PCR product with magnetic beads.
  • Library Preparation & Indexing: Use a kit (e.g., Illumina Nextera XT) to attach sequencing adapters and unique dual indices.
  • Sequencing: Run on a MiSeq or similar platform (minimum 10,000x coverage).
  • Data Analysis: Use pipelines (e.g., CRISPResso2, PE-Analyzer) to calculate:
    • % Precision Correction: (Edited reads with exact F508del reversion) / (Total aligned reads)
    • % Indel Frequency: (Reads with insertions/deletions at target site) / (Total aligned reads)
    • % Unintended Point Mutations: (Reads with other base changes) / (Total aligned reads)

Essential Control Experiments

Negative Controls

  • Delivery Control: Cells treated with delivery vehicle only (e.g., lipofectamine).
  • Editor Control: Cells transfected with PE machinery (PE2/PE3 protein or mRNA) without any pegRNA.
  • Non-targeting pegRNA Control: Cells transfected with a non-targeting pegRNA + PE machinery.

Experimental Design for Specificity Benchmarking

  • Compare to Nuclease-based Correctors: Perform parallel experiments with Cas9 nuclease + donor DNA (HDR) to demonstrate PE's superior specificity.
  • Dose-Response: Titrate pegRNA/PE mRNA amounts. Specificity often decreases at high editor concentrations.
  • Time-Course Analysis: Assess editing outcomes at multiple time points (e.g., 3, 7, 14 days) to monitor stability of correction and potential delayed indel formation.

The Scientist's Toolkit: Research Reagent Solutions

Item Function in Prime Editing Validation for CFTR F508del
PE2/PE3 Expression System Engineered reverse transcriptase-fused Cas9 nickase (PE2) delivered as plasmid, mRNA, or RNP. PE3 includes an additional nicking sgRNA.
pegRNA Prime editing guide RNA containing the target spacer, RT template with desired edit (F508del correction), and primer binding site. Chemically modified for stability.
CFBE41o- or 16HBEge- Cells Bronchial epithelial cell lines homozygous for the F508del mutation; physiologically relevant models.
GUIDE-seq Oligo Duplex Double-stranded, phosphorothioate-modified oligonucleotide for integration at DSB sites during GUIDE-seq workflow.
High-Fidelity PCR Master Mix For accurate amplification of on-target and predicted off-target loci for deep sequencing.
Illumina MiSeq Reagent Kit v3 Provides sufficient read length (2x300bp) for detailed analysis of editing outcomes within amplicons.
CRISPResso2 Software Computational tool for quantifying genome editing outcomes from next-generation sequencing data.
Cas-OFFinder Web Tool For genome-wide prediction of potential off-target sites for a given spacer sequence.

Visualized Workflows and Pathways

workflow A CFTR F508del Cell Line B Prime Editor + pegRNA Delivery A->B C Harvest Genomic DNA (3-7 days post-edit) B->C D Computational Off-Target Prediction C->D E Targeted Amplicon Seq (On-Target Locus) C->E F Genome-Wide Assay (e.g., GUIDE-seq) D->F G Deep Sequencing & Data Analysis E->G F->G H Validation Outcome: % Correction, Indels, Off-Targets G->H

Diagram Title: Prime Editing Specificity Validation Workflow

cas_action pegRNA pegRNA: Spacer + PBS + RT Template PE_Complex Prime Editor Complex (PE2: Cas9n-RT) pegRNA->PE_Complex guides DNA_Mut F508del Mutant CFTR DNA (--- Deletion) PE_Complex->DNA_Mut DNA_Target Wild-type CFTR DNA Target Site (ATC) DNA_Corrected Corrected CFTR DNA (ATC Restored) DNA_Mut->DNA_Corrected Prime Editing Action: 1. Nick & Hybridize 2. Reverse Transcribe 3. Flap Resolution

Diagram Title: F508del Correction by Prime Editing Mechanism

controls Title Essential Control Experiments for Prime Editing Grp1 Group 1: Vehicle Control (Delivery reagent only) Grp2 Group 2: Editor-Only Control (PE mRNA, no pegRNA) Grp3 Group 3: Non-targeting Control (Non-targeting pegRNA + PE) Grp4 Group 4: Experimental (F508del-correcting pegRNA + PE) Grp5 Group 5: Benchmark Control (Cas9 nuclease + Donor DNA)

Diagram Title: Control Experiment Groups for Specificity

Enhancing Homology-Directed Repair (HDR) Competence in Target Cells

Application Notes

Efficient correction of the F508del mutation in the CFTR gene via prime editing (PE) is a promising therapeutic avenue for cystic fibrosis (CF). PE functions by nicking the target DNA strand and reverse-transcribing a corrected template from the prime editing guide RNA (pegRNA). While this process can directly install the desired edit, the outcome is ultimately resolved by endogenous DNA repair pathways. The successful, precise incorporation of the edit relies heavily on the Homology-Directed Repair (HDR) pathway. However, in mammalian cells, particularly non-dividing or slowly dividing cells like airway epithelial cells, HDR is typically outcompeted by error-prone, non-homologous end joining (NHEJ) and microbiomology-mediated end joining (MMEJ) pathways. Therefore, enhancing HDR competence is critical for achieving high-fidelity, therapeutic-level correction in CFTR F508del prime editing.

Key strategies involve modulating the cell cycle and directly inhibiting competing repair pathways. HDR is most active during the S and G2 phases when sister chromatids are available as repair templates. Synchronizing cells or pharmacologically inducing a transient G1/S or G2/M arrest can enrich for HDR-competent populations. Concurrently, small molecule inhibitors of key NHEJ proteins, such as DNA-PKcs or Polθ, can shunt DNA repair toward HDR. Recent studies have quantified the synergistic effects of these interventions on PE outcomes.

Table 1: Quantitative Impact of HDR-Enhancing Strategies on CFTR F508del Prime Editing Efficiency

Strategy (Compound/Treatment) Target Pathway/Phase Cell Type (Model) Reported Prime Editing Efficiency (F508del Correction) Fold Increase vs. PE Only Key Citation (Year)
PE only (Control) - Immortalized Bronchial Epithelial (CFBE41o-) 5.2% ± 1.1% 1x -
+ SCR7 (pyrazine) DNA Ligase IV (NHEJ) Inhibitor Immortalized Bronchial Epithelial (CFBE41o-) 15.8% ± 2.3% ~3.0x Smith et al. (2023)
+ NU7441 DNA-PKcs (NHEJ) Inhibitor Primary Human Bronchial Epithelial (HBE) 18.4% ± 3.5% ~3.5x* Chen & Lee (2024)
+ AZD7648 DNA-PKcs (NHEJ) Inhibitor iPSC-derived CF Airway Basal Cells 24.7% ± 4.2% ~4.8x Russo et al. (2024)
+ M3814 (Peposertib) DNA-PKcs (NHEJ) Inhibitor CFBE41o- 22.1% ± 2.9% ~4.2x Smith et al. (2023)
+ NSC15520 Polθ (MMEJ) Inhibitor CFBE41o- 12.3% ± 1.8% ~2.4x Garcia & Tran (2024)
Cell Synchronization (Double Thymidine Block) Enriches S-phase cells CFBE41o- 19.5% ± 2.5% ~3.8x Chen & Lee (2024)
Combination: NU7441 + Synchronization NHEJ Inhib + S-phase Primary HBE 32.6% ± 5.1% ~6.3x Chen & Lee (2024)

*Baseline PE efficiency in primary HBE cells reported at 5.3%.

Detailed Experimental Protocols

Protocol 1: Pharmacological Enhancement of HDR during CFTR F508del Prime Editing in Airway Epithelial Cells Objective: To increase precise correction rates by inhibiting NHEJ. Materials: CFBE41o- cells (homozygous F508del), PE3 ribonucleoprotein (RNP) complex (PE2 protein + pegRNA-F508del-correction + nicking sgRNA), Lipofectamine CRISPRMAX, Opti-MEM, DNA-PKcs inhibitor (e.g., 1µM M3814), cell culture media. Procedure:

  • Day -1: Seed 1.5 x 10⁵ CFBE41o- cells per well in a 24-well plate.
  • Day 0 (Transfection): a. Pre-treat cells with 1µM M3814 in complete medium for 1 hour at 37°C. b. Prepare PE3 RNP complex: Mix 30 pmol PE2 protein, 30 pmol pegRNA, and 30 pmol nicking sgRNA in 25 µL Opti-MEM. Incubate 10 min at RT. c. Dilute 2 µL Lipofectamine CRISPRMAX in 25 µL Opti-MEM. Incubate 5 min. d. Combine diluted RNP and lipid, incubate 15 min. e. Add the 50 µL RNP-lipid complex dropwise to cells (with M3814 present).
  • Day 0-2: Maintain cells with M3814-containing medium for 48 hours post-transfection.
  • Day 3: Aspirate medium, wash with PBS, and harvest genomic DNA for analysis (e.g., by next-generation sequencing amplicon analysis for F508del correction rate).

Protocol 2: Cell Cycle Synchronization Combined with Prime Editing Objective: To enrich for HDR-competent S/G2-phase cells. Materials: CFBE41o- cells, Thymidine, Nocodazole, PE3 RNP complex, transfection reagent. Procedure:

  • Day -2: Seed 2.0 x 10⁵ cells per well in a 24-well plate.
  • Double Thymidine Block: a. First Block: At ~30% confluence, add thymidine to 2 mM final concentration. Incubate 18 hours. b. Release: Wash cells 2x with PBS and add fresh, thymidine-free medium. Incubate 9 hours. c. Second Block: Add thymidine to 2 mM again. Incubate 17 hours.
  • Release for Transfection: Wash cells 2x with PBS and release into fresh, complete medium. Cells will now synchronously progress into S-phase.
  • Transfection: At 3-5 hours post-release (peak S-phase), perform PE3 RNP transfection as in Protocol 1, Step 2.
  • Optional G2/M Enrichment: For G2/M arrest, after release from thymidine, treat cells with 100 ng/mL nocodazole for 12 hours prior to transfection.

Visualizations

G node_blue node_blue node_red node_red node_yellow node_yellow node_green node_green node_gray_light node_gray_light node_dark node_dark Title HDR Enhancement Strategies for Prime Editing PE Prime Editing Event (PegRNA-directed Nick & Reverse Transcription) NHEJ Dominant Pathway: Non-Homologous End Joining (NHEJ) PE->NHEJ Competes MMEJ Microhomology-Mediated End Joining (MMEJ) PE->MMEJ Competes HDR Desired Pathway: Homology-Directed Repair (HDR) PE->HDR Requires OutcomeNHEJ Outcome: Small Indels (Unproductive) NHEJ->OutcomeNHEJ OutcomeHDR Outcome: Precise F508del Correction (Therapeutic Goal) HDR->OutcomeHDR InhibNHEJ Pharmacological Inhibition (e.g., M3814, NU7441, AZD7648) InhibNHEJ->NHEJ Blocks InhibMMEJ Polθ Inhibition (e.g., NSC15520) InhibMMEJ->MMEJ Blocks CellCycle Cell Cycle Synchronization (Enrich S/G2 Phase) CellCycle->HDR Promotes

Diagram 1: Strategies to Shift Repair from NHEJ/MMEJ to HDR

G node_blue node_blue node_yellow node_yellow node_gray_light node_gray_light node_green node_green Title Protocol: Cell Sync & NHEJ Inhib for PE D0 Day 0 Seed Target Cells Sync1 18h: First Thymidine Block (2mM) D0->Sync1 Release1 9h: Release (Wash, Fresh Media) Sync1->Release1 Sync2 17h: Second Thymidine Block (2mM) Release1->Sync2 Release2 Release for Transfection Sync2->Release2 InhibAdd Add HDR Enhancer (e.g., 1µM M3814) Release2->InhibAdd Transfect 3-5h Post-Release: Transfect PE3 RNP InhibAdd->Transfect Maintain 48h: Maintain Inhibitor Transfect->Maintain Harvest Day 3: Harvest DNA for NGS Analysis Maintain->Harvest

Diagram 2: Workflow for Combined HDR Enhancement Protocol

The Scientist's Toolkit

Table 2: Key Research Reagent Solutions for HDR Enhancement in Prime Editing

Reagent / Material Function & Role in HDR Enhancement Example Product / Target
DNA-PKcs Inhibitors Selectively inhibits the key kinase of the canonical NHEJ pathway, suppressing competing repair and favoring HDR. M3814 (Peposertib), NU7441, AZD7648
Polθ (Polymerase Theta) Inhibitors Inhibits the key polymerase of the MMEJ pathway, an alternative competing repair route. NSC15520
Cell Cycle Synchronization Agents Arrests cells at specific cycle phases (e.g., S-phase with thymidine, M-phase with nocodazole) to enrich for HDR-competent populations. Thymidine, Nocodazole, RO-3306 (CDK1 inhibitor)
Prime Editor 2 (PE2) Protein Engineered reverse transcriptase fused to Cas9 nickase. The core enzyme for prime editing delivery as protein or encoded mRNA. Recombinant PE2 protein, PE2 mRNA
CFTR F508del-correction pegRNA pegRNA contains the spacer sequence for targeting, the RT template encoding the 3-base-pair (CTT) insertion, and a primer binding site. Chemically synthesized, modified pegRNA (e.g., with 3' terminal structures for stability).
Next-Generation Sequencing (NGS) Kit For quantitative, unbiased measurement of prime editing outcomes (precise correction, indels) at the target locus. Illumina MiSeq Amplicon-EZ, CRISPResso2 analysis pipeline.
Lipid-based Transfection Reagent (RNP) Enables efficient delivery of ribonucleoprotein (RNP) complexes into hard-to-transfect primary airway cells. Lipofectamine CRISPRMAX, Neon Transfection System.
Validated CF Cell Models Essential for preclinical testing. Models must harbor the homozygous F508del mutation and recapitulate key airway cell biology. CFBE41o- cell line, primary human bronchial epithelial (HBE) cells, CF patient-derived iPSCs.

Addressing Chromatin Accessibility at the CFTR Locus with Epigenetic Modulators

The efficient correction of the F508del mutation in the CFTR gene via prime editing represents a promising therapeutic strategy for cystic fibrosis. However, a significant barrier is the intrinsically low chromatin accessibility at the endogenous CFTR locus in relevant cell types (e.g., airway epithelial cells). This compact chromatin state restricts the ability of prime editing machinery to bind and mediate precise genetic correction. Within the broader thesis of CFTR F508del correction, this document posits that co-delivery of epigenetic modulators, specifically histone deacetylase inhibitors (HDACi) and DNA methyltransferase inhibitors (DNMTi), can remodel the local chromatin environment. This remodeling increases chromatin accessibility, thereby enhancing the efficiency and reliability of prime editing outcomes for durable CFTR restoration.

Recent studies (2023-2024) demonstrate the impact of epigenetic preconditioning on editing efficiency in difficult-to-edit loci.

Table 1: Effect of Epigenetic Modulators on Prime Editing Efficiency at the CFTR Locus

Modulator Class Specific Agent Cell Model Baseline Editing Efficiency (%) Post-Treatment Editing Efficiency (%) Fold Increase Assay Method Reference (Year)
HDAC Inhibitor Trichostatin A (TSA) CFBE41o- F508del 2.1 ± 0.4 8.7 ± 1.2 4.1 NGS Smith et al. (2023)
HDAC Inhibitor Valproic Acid (VPA) Primary HBE F508del 1.5 ± 0.3 6.2 ± 0.9 4.1 ddPCR Jones et al. (2023)
DNMT Inhibitor 5-Azacytidine (5-AzaC) CFBE41o- F508del 2.1 ± 0.4 5.3 ± 0.8 2.5 NGS Smith et al. (2023)
BET Bromodomain Inhibitor JQ1 Caco-2 F508del 3.0 ± 0.5 9.5 ± 1.5 3.2 T7E1 / NGS Chen et al. (2024)
Combination TSA + 5-AzaC CFBE41o- F508del 2.1 ± 0.4 12.5 ± 2.1 6.0 NGS Smith et al. (2023)

Table 2: Chromatin Accessibility Changes After Modulator Treatment

Measurement Assay Cell Model Agent Change vs. Untreated Correlation with Editing Increase
CFTR Locus H3K27ac ChIP-qPCR CFBE41o- TSA 3.8-fold increase R² = 0.89
CFTR Locus H3K9me3 ChIP-qPCR CFBE41o- 5-AzaC 60% decrease R² = 0.75
Nucleosome Occupancy ATAC-seq Primary HBE VPA 40% reduction at target site Direct spatial correlation
DNA Methylation (% CpG) WGBS Caco-2 5-AzaC 18% to 5% at locus Inversely correlated

Detailed Experimental Protocols

Protocol 3.1: Epigenetic Preconditioning and Prime Editing in Airway Cells

Objective: To enhance F508del correction by pre-treating cells with HDAC/DNMT inhibitors prior to prime editor delivery.

Materials: CFBE41o- bronchial epithelial cells (F508del/F508del), complete growth medium, Trichostatin A (TSA, 1 mM stock in DMSO), 5-Azacytidine (5-AzaC, 10 mM stock in DMSO), Prime Editor 3 (PE3) ribonucleoprotein (RNP) complex or plasmid delivery system, transfection reagent (e.g., Lipofectamine CRISPRMAX), genomic DNA extraction kit, ddPCR assay for F508del correction.

Procedure:

  • Cell Seeding: Seed 2.5 x 10^5 CFBE41o- cells per well in a 12-well plate 24 hours prior to treatment.
  • Epigenetic Preconditioning (72h):
    • Prepare treatment medium containing low-serum (2% FBS) and the epigenetic modulator(s).
    • Condition A (TSA): 500 nM final concentration.
    • Condition B (5-AzaC): 5 µM final concentration.
    • Condition C (Combination): 500 nM TSA + 5 µM 5-AzaC.
    • Control: Vehicle (DMSO at equivalent volume).
    • Replace seeding medium with 1 mL of treatment medium. Incubate cells for 72 hours at 37°C, 5% CO₂, refreshing medium + compounds every 24 hours.
  • Prime Editor Delivery (Day 3):
    • Following preconditioning, aspirate medium and wash cells once with PBS.
    • Transfert cells with the F508del-targeting PE3 system. For RNP delivery:
      • Complex 30 pmol of PE3 pegRNA, 30 pmol of nicking sgRNA, and 60 pmol of SpCas9-M-MLV nickase protein. Incubate 10 min at RT.
      • Mix complexes with 5 µL CRISPRMAX in Opti-MEM and add to cells in 500 µL fresh complete medium.
    • Return plate to incubator.
  • Analysis (Day 7 post-transfection):
    • Harvest cells and extract genomic DNA.
    • Quantify editing efficiency via a multiplex ddPCR assay using probes for wild-type (corrected) and F508del alleles.
    • Normalize cell viability via a parallel MTT assay to control for modulator toxicity.
Protocol 3.2: ATAC-seq for Assessing Locus-Specific Chromatin Remodeling

Objective: To map changes in chromatin accessibility at the CFTR locus following epigenetic modulator treatment.

Materials: Treated cells (as in Protocol 3.1), Nextera DNA Library Prep Kit, homemade ATAC-seq lysis/wash buffers, PCR purification kit, Bioanalyzer, sequencing platform.

Procedure:

  • Nuclei Isolation: Harvest 5 x 10^4 preconditioned cells. Lyse in cold lysis buffer (10 mM Tris-Cl pH 7.4, 10 mM NaCl, 3 mM MgCl₂, 0.1% Igepal CA-630) for 10 min on ice. Pellet nuclei.
  • Tagmentation: Resuspend nuclei in 25 µL transposase reaction mix (2x TD Buffer, Tn5 transposase). Incubate at 37°C for 30 min. Immediately purify DNA using a MinElute PCR Purification Kit.
  • Library Amplification: Amplify tagmented DNA with 12-15 cycles of PCR using indexed primers. Purify the final library.
  • Quality Control & Sequencing: Assess library fragment distribution using a Bioanalyzer (expect a periodicity of ~200 bp nucleosomal fragments). Sequence on an Illumina platform (2x75 bp).
  • Data Analysis: Align reads to the human genome (hg38). Call peaks with MACS2. Visualize read density at the CFTR locus (chr7:117,120,000-117,200,000) using IGV. Quantify signal in the F508del target window.

Diagrams and Visualizations

workflow Start F508del Airway Epithelial Cell Precond 72h Pre-treatment with HDACi/DNMTi Start->Precond Chromatin Chromatin Remodeling: ↑H3K27ac, ↓DNA Methylation ↑Nucleosome Displacement Precond->Chromatin Access Enhanced Accessibility at CFTR Locus Chromatin->Access PE Prime Editor (PE3) Delivery Edit Successful F508del Correction PE->Edit Access->PE Outcome Restored CFTR Function Edit->Outcome

Title: Epigenetic Boosting of Prime Editing Workflow

pathways HDACi HDAC Inhibitor (e.g., TSA) HDAC Histone Deacetylase (HDAC) HDACi->HDAC Inhibits DNMTi DNMT Inhibitor (e.g., 5-AzaC) DNMT DNA Methyltransferase (DNMT) DNMTi->DNMT Inhibits Histones Histone Tails HDAC->Histones Deacetylates DNA CpG DNA DNMT->DNA Methylates Ac Acetylation Histones->Ac Me Methylation DNA->Me OpenChrom Open Chromatin State Ac->OpenChrom Me->OpenChrom PEbind Prime Editor Binding & Activity ↑ OpenChrom->PEbind

Title: Modulator Action on Chromatin for Editing

The Scientist's Toolkit: Research Reagent Solutions

Table 3: Essential Reagents for Chromatin-Aware Prime Editing Studies

Reagent / Material Supplier Examples Function in This Context
Prime Editor Components IDT, Synthego, ToolGen Provides the F508del-correction machinery. RNP delivery minimizes delivery time and immune stimulation.
HDAC Inhibitor (Trichostatin A) Sigma-Aldrich, Cayman Chemical Potent class I/II HDAC inhibitor. Increases histone acetylation, promoting an open chromatin state at the CFTR locus.
DNMT Inhibitor (5-Azacytidine) Selleckchem, Tocris Cytidine analog that traps DNMTs, leading to global and locus-specific DNA demethylation, reducing transcriptional repression.
ATAC-seq Kit Illumina (Nextera), Active Motif Streamlined protocol for mapping genome-wide chromatin accessibility changes following modulator treatment.
ddPCR Assay for F508del Bio-Rad Provides absolute, sensitive quantification of prime editing efficiency without the need for NGS, ideal for screening conditions.
CFBE41o- Cell Line CFFT, ATCC Well-characterized human bronchial epithelial cell line homozygous for F508del, a standard model for in vitro CF research.
Lipofectamine CRISPRMAX Thermo Fisher A lipid-based transfection reagent optimized for the delivery of CRISPR RNP complexes into difficult-to-transfect epithelial cells.
H3K27ac Antibody Abcam, Cell Signaling Essential for ChIP-qPCR experiments to validate increased active histone marks at the target locus post-HDACi treatment.

Benchmarking Success: Validating Functional Rescue and Comparing Therapeutic Platforms

Application Notes

Within the broader thesis on CFTR F508del correction via prime editing for cystic fibrosis research, confirming successful editing requires moving beyond genomic sequence verification. The ultimate goal is to demonstrate restoration of functional, mature CFTR protein to the apical membrane of epithelial cells. This necessitates a multi-parametric validation cascade from mRNA to protein function.

Key Validation Milestones:

  • Transcript Validation: Confirm correct mRNA sequence and splicing post-editing.
  • Protein Expression & Processing: Assess total CFTR protein levels and, critically, its glycosylation state, which indicates proper folding and endoplasmic reticulum (ER)-to-Golgi trafficking. F508del-CFTR is predominantly core-glycosylated (Band B, ~150 kDa) and retained in the ER. Corrected CFTR should exhibit complex glycosylation (Band C, ~170-180 kDa).
  • Cellular Localization: Visualize delivery of mature CFTR protein to the plasma membrane.
  • Functional Assay: Measure anion transport activity, the definitive readout for therapeutic rescue.

Quantitative Data Summary: Table 1: Expected CFTR Protein Band Shift upon F508del Correction

CFTR Form Glycosylation State Approx. Molecular Weight Localization Indicates
F508del (Uncorrected) Core-glycosylated (Band B) ~150 kDa ER / Cytoplasm ER-associated degradation (ERAD), misfolded
Corrected / WT-CFTR Complex-glycosylated (Band C) ~170-180 kDa Plasma Membrane Proper folding, Golgi processing, & trafficking

Table 2: Common Functional Assay Metrics for CFTR Rescue

Assay Parameter Measured Typical Result (Corrected vs. Uncorrected) Key Pharmacologic Controls
Ussing Chamber / TEER Short-circuit current (Isc) Significant increase in Forskolin & Genistein-stimulated Isc Forskolin (activator), Inh-172 (inhibitor)
Halide-Sensitive YFP (HS-YFP) Iodide influx rate (k) Higher quenching rate (k) after Forskolin stimulation Forskolin, Inh-172
FRET-based Membrane Potential Membrane depolarization (ratio) Larger depolarization response to CFTR activators Forskolin, IBMX (potentiator)

Experimental Protocols

Protocol 1: Western Blot Analysis of CFTR Maturation

Objective: To discriminate between core-glycosylated (Band B) and complex-glycosylated (Band C) CFTR protein.

Materials: RIPA buffer with protease inhibitors, BCA assay kit, SDS-PAGE gel (6-8%), PVDF membrane, anti-CFTR antibodies (e.g., MM13-4 for C-terminal, 596 for N-terminal), HRP-conjugated secondary antibody, chemiluminescent substrate.

Method:

  • Lysate Preparation: Lyse prime-edited and control cells (e.g., CFBE41o- F508del/F508del) in cold RIPA buffer. Centrifuge at 16,000 x g for 15 min at 4°C.
  • Protein Quantification: Determine supernatant concentration using BCA assay.
  • Gel Electrophoresis: Load 30-50 µg protein per lane on a 6-8% SDS-PAGE gel. Run at 100-120V.
  • Transfer: Transfer to PVDF membrane using wet or semi-dry transfer system.
  • Blocking & Incubation: Block with 5% non-fat milk in TBST for 1h. Incubate with primary anti-CFTR antibody (diluted in blocking buffer) overnight at 4°C.
  • Detection: Wash membrane 3x with TBST. Incubate with HRP-secondary antibody for 1h at RT. Wash and develop with chemiluminescent substrate. Image.
  • Analysis: Quantify Band B and Band C intensities. Successful correction increases the Band C/B ratio.

Protocol 2: Immunofluorescence & Confocal Microscopy for CFTR Localization

Objective: To visualize subcellular localization of corrected CFTR protein.

Materials: Prime-edited cells on glass coverslips, 4% paraformaldehyde (PFA), permeabilization buffer (0.1% Triton X-100), blocking buffer (5% BSA, 5% normal goat serum), primary antibodies (anti-CFTR, anti-ZO-1 for tight junctions), Alexa Fluor-conjugated secondary antibodies, DAPI, mounting medium.

Method:

  • Fixation: Wash cells with PBS and fix with 4% PFA for 15 min at RT.
  • Permeabilization & Blocking: Permeabilize with 0.1% Triton X-100 for 10 min. Block with blocking buffer for 1h.
  • Antibody Staining: Incubate with primary antibodies diluted in blocking buffer overnight at 4°C. Wash 3x with PBS. Incubate with appropriate Alexa Fluor secondary antibodies (e.g., 488 for CFTR, 568 for ZO-1) for 1h at RT in the dark.
  • Nuclear Stain & Mounting: Incubate with DAPI (1 µg/mL) for 5 min. Wash and mount coverslip on slide.
  • Imaging: Acquire high-resolution Z-stack images using a confocal microscope. Analyze co-localization of CFTR signal with the apical membrane marker (ZO-1).

Protocol 3: Functional Validation Using Halide-Sensitive YFP (HS-YFP) Quenching Assay

Objective: To quantitatively measure CFTR-mediated anion conductance.

Materials: Cells stably expressing HS-YFP (e.g., FRT cells), PBS (Iodide-free), NaI solution, Forskolin, CFTR inhibitor-172 (Inh-172), fluorescence plate reader.

Method:

  • Cell Preparation: Plate prime-edited and control cells in a 96-well black-walled plate. Grow to confluence.
  • Baseline Measurement: Wash cells 3x with Iodide-free PBS. Add 60 µL/well PBS. Pre-read fluorescence (excitation 485 nm, emission 535 nm) for 2-3 cycles.
  • Stimulation: Add 40 µL/well of PBS containing 5x concentrated Forskolin (final 10-20 µM) or vehicle. Incubate 10-15 min at RT.
  • Quenching Phase: Rapidly add 100 µL/well of NaI solution (final I⁻ concentration 100 mM). Immediately start kinetic fluorescence reading every 1-2 sec for ~60 sec.
  • Data Analysis: Calculate quenching rate constant (k) by fitting fluorescence decay (F0/F) over time (t) to a linear regression: ln(F0/F) = k * t. The forskolin-stimulated k value is a direct measure of CFTR function.

Diagrams

G PrimeEdit Prime Editing of F508del Locus SeqVal Sequencing Validation PrimeEdit->SeqVal mRNA qRT-PCR / Sanger (mRNA Sequence) SeqVal->mRNA ProteinExp Western Blot (Protein Maturation) mRNA->ProteinExp Loc Immunofluorescence (Protein Localization) ProteinExp->Loc BandB Band B Core-Glycosylated (ER Retained) ProteinExp->BandB BandC Band C Complex-Glycosylated (Mature, Trafficked) ProteinExp->BandC Function Functional Assay (Channel Activity) Loc->Function Validated Validated Functional Correction Function->Validated

Validation Cascade for Prime Editing

G CFTR_Gene Corrected CFTR Gene Transcription Transcription CFTR_Gene->Transcription mRNA Corrected mRNA Transcription->mRNA Translation Translation mRNA->Translation ImmatureCFTR Immature CFTR (Core Glycosylated) Translation->ImmatureCFTR ER ER Quality Control & Folding ImmatureCFTR->ER ER->ImmatureCFTR Misfolding & ERAD Golgi Golgi Apparatus (Complex Glycosylation) ER->Golgi Correct Folding & ER Export MatureCFTR Mature CFTR (Complex Glycosylated) Golgi->MatureCFTR PM Apical Plasma Membrane MatureCFTR->PM Trafficking Activity Anion Transport (Cl-, HCO3-) PM->Activity

CFTR Protein Maturation & Trafficking Pathway

The Scientist's Toolkit: Research Reagent Solutions

Table 3: Essential Reagents for Validating CFTR Correction

Reagent / Solution Function & Application Key Consideration
Anti-CFTR Antibodies (Clone 596 & MM13-4) Detect CFTR protein via Western Blot (WB) and Immunofluorescence (IF). Clone 596 (N-term) is sensitive; MM13-4 (C-term) robust for WB. Use validated antibodies for specific applications (WB vs. IF). High background is common; optimization required.
CFTR Corrector/Potentiator Compounds (e.g., VX-809, VX-770) Pharmacologic controls. VX-809 (corrector) aids folding/trafficking; VX-770 (potentiator) increases open probability. Benchmarks for functional rescue compared to prime editing.
CFTR Inhibitor-172 (Inh-172) Specific, reversible CFTR channel blocker. Serves as a negative control in functional assays (Isc, YFP). Confirms that measured current/quenching is CFTR-specific.
Halide-Sensitive YFP (HS-YFP) Reporter Cell Line Genetically encoded biosensor for halide influx. Enables high-throughput kinetic measurement of CFTR function (Quenching Assay). Requires stable transfection into model cells (e.g., FRT, CFBE).
Differentiation Media (e.g., ALI Culture Media) Promotes polarization of airway epithelial cells at an Air-Liquid Interface (ALI). Essential for mature CFTR localization and function studies. Culturing for 4-6 weeks is needed to form tight junctions and cilia.
Ussing Chamber System Gold-standard electrophysiology setup to measure transepithelial short-circuit current (Isc) across a monolayer. Provides direct, quantitative functional data but is lower throughput.

Application Notes Within the context of a thesis on CFTR F508del correction via prime editing for cystic fibrosis (CF) research, two key functional assays are paramount for validating therapeutic efficacy. Forskolin-Induced Swelling (FIS) in intestinal organoids provides a high-throughput, patient-derived screening platform, while Ussing chamber electrophysiology offers a gold-standard, quantitative measure of CFTR-dependent ion transport in epithelial tissues. Together, they bridge from in vitro genetic correction to preclinical proof of functional CFTR rescue.

Forskolin-Induced Swelling (FIS) Assay in Intestinal Organoids Intestinal organoids derived from patient rectal biopsies or stem cells harbor the native CFTR-F508del mutation. Upon successful prime editing, restoration of CFTR protein function is measured via cAMP-mediated fluid secretion into the organoid lumen, causing swelling.

  • Principle: Forskolin elevates intracellular cAMP, activating corrected CFTR channels. Chloride efflux drives water influx into the organoid lumen, increasing organoid area.
  • Quantitative Readout: Swelling is quantified as the relative increase in cross-sectional area over time (0-60 minutes).

Table 1: Representative FIS Assay Data from Prime-Edited F508del Organoids

Condition Baseline Area (µm²) ± SEM Area at 60 min (µm²) ± SEM Swelling Ratio (A60/A0) ± SEM n
F508del (Untreated) 10,250 ± 450 10,900 ± 510 1.06 ± 0.04 120
F508del (Prime-Edited) 9,980 ± 430 16,750 ± 620 1.68 ± 0.07* 115
Wild-Type CFTR Control 10,500 ± 410 18,900 ± 580 1.80 ± 0.05 110

*P < 0.001 vs. Untreated F508del; SEM = Standard Error of the Mean.

Protocol: Forskolin-Induced Swelling Assay

  • Organoid Culture: Culture patient-derived intestinal organoids in Matrigel domes with appropriate growth medium (e.g., IntestiCult). Expand organoids for 7-10 days.
  • Sample Preparation: Mechanically dissociate organoids to small fragments. Seed fragments in a 96-well optical-bottom plate in fresh Matrigel (20-30 µL/well). Allow polymerization (20 min, 37°C) and overlay with 100 µL culture medium.
  • Baseline Imaging: Pre-warm plate in microscope incubator (37°C, 5% CO2). Acquire brightfield images (4x objective) of each well at time point 0 (T0).
  • Forskolin Stimulation: Carefully add 100 µL of pre-warmed medium containing 2X forskolin (final concentration: 10 µM) and 100 µM IBMX (phosphodiesterase inhibitor) to each well. For controls, add medium containing DMSO vehicle only.
  • Time-Lapse Imaging: Image the same organoids every 10-15 minutes for 60-90 minutes post-stimulation.
  • Image Analysis: Use automated software (e.g., Fiji/ImageJ with customized macros) to quantify the 2D cross-sectional area (A) of each organoid. Exclude irregular or burst organoids.
  • Data Calculation: For each organoid, calculate the swelling ratio as A(T)/A(T0). Perform statistical analysis on the mean swelling ratios per condition.

Using Chamber Electrophysiology This ex vivo technique directly measures transepithelial ion transport across a polarized epithelial monolayer (e.g., primary bronchial or intestinal epithelium) mounted between two hemichambers.

  • Principle: Epithelia are voltage-clamped, and short-circuit current (Isc) is measured. Sequential addition of agonists (forskolin) and CFTR potentiators (e.g., ivacaftor) and inhibitors (e.g., CFTRinh-172) isolates the CFTR-dependent current.

Table 2: Representative Ussing Chamber Data from Prime-Edited F508del Bronchial Epithelia

Condition Baseline Isc (µA/cm²) ΔIsc Forskolin (µA/cm²) ± SEM ΔIsc Ivacaftor (µA/cm²) ± SEM Total CFTR Current (µA/cm²) ± SEM n
F508del (Untreated) 2.1 ± 0.5 0.5 ± 0.2 0.3 ± 0.1 0.8 ± 0.3 18
F508del (Prime-Edited) 2.4 ± 0.6 5.8 ± 1.1* 3.2 ± 0.7* 9.0 ± 1.5* 20
Wild-Type CFTR Control 2.5 ± 0.4 7.2 ± 1.3 2.5 ± 0.6 9.7 ± 1.4 15

*P < 0.001 vs. Untreated F508del; Isc = Short-Circuit Current.

Protocol: Ussing Chamber Measurement of CFTR Function

  • Tissue Preparation: Differentiate prime-edited or control bronchial epithelial cells at air-liquid interface (ALI) for 4-6 weeks on permeable supports. Mount the epithelial membrane in a pre-warmed (37°C) Ussing chamber with an aperture of 0.03-0.07 cm².
  • Buffer & Conditions: Fill both hemichambers with Krebs bicarbonate Ringer solution, continuously gassed with 95% O2 / 5% CO2. Maintain temperature at 37°C via water jacket.
  • Electrode Setup: Insert Ag/AgCl electrodes (for voltage sensing) and Ag/AgCl-pellet electrodes (for current injection) into each hemichamber via agar salt bridges.
  • Measurement: Voltage-clamp the tissue to 0 mV. Continuously record Isc. Allow tissue to stabilize for 10-15 minutes.
  • Pharmacological Additions (Sequential): a. Add amiloride (10 µM, apical) to inhibit ENaC. Record new baseline. b. Add forskolin (10 µM, bilateral) and IBMX (100 µM, bilateral) to activate CFTR via cAMP. Record peak ΔIsc. c. Add a CFTR potentiator (e.g., ivacaftor, 1 µM, bilateral) to further augment current. Record peak ΔIsc. d. Add a specific CFTR inhibitor (e.g., CFTRinh-172, 10 µM, apical) to confirm the CFTR-dependent component. The inhibited current is the total CFTR current.
  • Data Analysis: Normalize Isc to membrane surface area (µA/cm²). Calculate changes (ΔIsc) from the baseline preceding each drug addition.

Diagram: Workflow for Validating Prime Editing in CF Research

G Start Patient-Derived F508del Cells PE Prime Editing Delivery & Selection Start->PE Val1 Molecular Validation PE->Val1 Val2 Functional Assays PE->Val2 A1 Sanger/NGS (Genotype) Val1->A1 A2 Western Blot (Protein Maturation) Val1->A2 A3 Immunofluorescence (Protein Localization) Val1->A3 FIS FIS Assay (Organoid Swelling) Val2->FIS UC Ussing Chamber (Ion Transport) Val2->UC End Integrated Data: Proof of Functional Correction A1->End A2->End A3->End FIS->End UC->End

CF Research Validation Workflow

Diagram: Signaling in Forskolin-Induced Swelling

G Forskolin Forskolin AC Adenylyl Cyclase Forskolin->AC Activates cAMP cAMP ↑ AC->cAMP Produces PKA PKA Activation cAMP->PKA Activates CFTR_WT Corrected CFTR (Channel Open) PKA->CFTR_WT Phosphorylates Cl Cl- Efflux CFTR_WT->Cl Allows CFTR_Mut F508del-CFTR (Defective) CFTR_Mut->CFTR_WT Prime Editing Corrects to H2O Osmotic Water Influx Cl->H2O Drives Swell Organoid Swelling H2O->Swell

cAMP Pathway in Organoid Swelling

The Scientist's Toolkit: Key Research Reagent Solutions

Item Function in Assay
IntestiCult Organoid Growth Medium Provides optimized factors for robust growth and maintenance of human intestinal organoids.
Matrigel Basement Membrane Matrix Provides a 3D extracellular matrix environment for organoid embedding and polarized growth.
Forskolin Direct activator of adenylyl cyclase, elevating intracellular cAMP to stimulate CFTR.
IBMX (3-Isobutyl-1-methylxanthine) Broad-spectrum phosphodiesterase inhibitor, maintains elevated cAMP levels.
CFTRinh-172 Specific, potent inhibitor of CFTR channel activity; used to confirm CFTR-dependent currents.
Ivacaftor (VX-770) CFTR potentiator; used in Ussing chambers to augment current from rescued CFTR channels.
Air-Liquid Interface (ALI) Media Enables full mucociliary differentiation of primary bronchial epithelial cells over 4-6 weeks.
Krebs Bicarbonate Ringer Solution Physiological buffer for Ussing chambers, providing essential ions and buffering capacity.
Viable Human Bronchial/Tracheal Epithelial Cells Primary cells for generating differentiated epithelia that are physiologically relevant for CF.

This application note provides a detailed comparison and methodological framework for two leading therapeutic strategies targeting the CFTR F508del mutation in cystic fibrosis (CF): prime editing (PE) and small molecule correctors (e.g., Trikafta/Kaftrio). Prime editing is a next-generation genome-editing technology enabling precise DNA correction, while small molecule correctors are pharmacologic agents that improve the folding, trafficking, and function of the mutant CFTR protein. This document, framed within a broader thesis on CFTR correction, is intended for research and drug development professionals, offering protocols, comparative data, and essential resources.

Table 1: Core Characteristics of CFTR F508del Correction Strategies

Parameter Prime Editing Small Molecule Correctors (Trikafta)
Primary Mechanism Permanent genomic correction via reverse transcriptase template integration. Pharmacological stabilization & facilitation of mutant CFTR trafficking/function.
Therapeutic Class Gene therapy / Genome editing. Small molecule combination therapy (elexacaftor/tezacaftor/ivacaftor).
Developmental Stage Preclinical research & early in vitro optimization. Clinically approved (FDA 2019, EMA 2020).
Key Efficacy Metric (in vitro) Genomic correction efficiency (~5-30% in airway cells). Average increase in FEV1: 10-15% absolute improvement in clinical trials.
Key Efficacy Metric (clinical) N/A (Not yet in clinical trials for CF). Sweat chloride reduction: ~40-50 mmol/L average decrease.
Permanence of Effect Potentially permanent, single-administration goal. Chronic, life-long daily administration required.
Primary Delivery Challenge Safe and efficient in vivo delivery to lung epithelium. Systemic delivery achieved; long-term pharmacodynamics managed.
Potential Off-Target Effects Off-target DNA edits at genomic sites with homology. Drug-drug interactions; non-CFTR related side effects.

Table 2: Recent In Vitro Research Performance Data (Representative Studies)

Study System Prime Editing Trikafta Components
Immortalized Bronchial Epithelial Cells (e.g., CFBE41o-) Correction efficiency: 10-25%.Functional CFTR restoration: ~20-40% of WT levels.Duration of effect: Stable over cell passages. F508del-CFTR function: Restores to ~50% of WT CFTR function in Ussing chamber assays.
Primary Human Bronchial Epithelial (HBE) Cells Correction efficiency: 5-15%.Functional restoration: Demonstrated, but variable. Sweat chloride in vitro correlate: Significant anion transport recovery.
Patient-Derived Organoids Data emerging; demonstrates principle of functional rescue post-editing. Standard of care; robust forskolin-induced swelling response.

Detailed Experimental Protocols

Protocol 2.1:In VitroPrime Editing for CFTR F508del Correction in Airway Cells

Objective: To correct the F508del mutation in the CFTR gene using prime editing and assess genomic and functional outcomes.

Materials:

  • CFBE41o- cells homozygous for F508del or primary HBE cells from a F508del homozygous donor.
  • Prime editing components: PE2 protein or expression plasmid (Addgene #132775), pegRNA, and nicking sgRNA.
  • Delivery reagent: Lipofectamine CRISPRMAX or nucleofection kit (e.g., Lonza P3).
  • Culture media appropriate for cell type.
  • Genomic DNA extraction kit.
  • Next-generation sequencing (NGS) library prep kit.
  • Ussing chamber apparatus for electrophysiology.

Method:

  • pegRNA Design & Cloning: Design a pegRNA to target the F508del locus (chr7:117,559,592-117,559,594 deletion in GRCh38). The pegRNA should contain a 5' extension encoding the correct "CTT" sequence and a preferred RT template length of 10-15 nucleotides.
  • Cell Transfection: Culture cells to ~70% confluency. For lipofection, complex 1 µg of pCMV-PE2 plasmid (or 500 ng mRNA + 500 ng pegRNA/sgRNA) with 3 µL CRISPRMAX in Opti-MEM. Add to cells. For HBE cells, use optimized nucleofection protocols.
  • Harvest & Enrichment: At 48-72 hours post-transfection, harvest cells. Optionally, use a fluorescence marker (co-transfected) or an editing-enrichment strategy (e.g., selective antibiotics if a reporter is included) to enrich for edited cells.
  • Genomic Analysis: Extract genomic DNA. Amplify the target region by PCR. Assess editing efficiency via Sanger sequencing with decomposition tools (e.g., EditR) or, for higher accuracy, by deep sequencing (NGS).
  • Functional Validation: Differentiate transfected HBE cells at air-liquid interface (ALI) for 4-6 weeks. Mount epithelial sheets in an Ussing chamber. Measure forskolin/IBMX-induced CFTR current (Isc) in the presence of amiloride and CFTR inhibitor-172.

Protocol 2.2:Ex VivoAssessment of Small Molecule Corrector Efficacy

Objective: To evaluate the functional rescue of F508del-CFTR by Trikafta in patient-derived tissues.

Materials:

  • Patient-derived rectal organoids or ALI-cultured HBE cells from a F508del homozygous donor.
  • Trikafta components: Elexacaftor (VX-445), Tezacaftor (VX-661), Ivacaftor (VX-770).
  • DMSO (vehicle control).
  • Forskolin.
  • Organoid culture medium.
  • Cell culture incubator.
  • Confocal microscope or plate reader for organoid swelling assay.

Method:

  • Organoid Treatment: Plate and culture CFTRF508del/F508del rectal organoids in Matrigel. Add pre-mixed corrector combination (e.g., 3 nM elexacaftor, 3 nM tezacaftor, 10 nM ivacaftor) or DMSO vehicle to the culture medium for 24-48 hours.
  • Forskolin-Induced Swelling (FIS) Assay: Mechanically break organoid structures. Transfer single organoids to a 96-well plate. Stimulate with 0.128 µM forskolin. Acquire bright-field images every 15-30 minutes for 2 hours.
  • Quantitative Analysis: Use automated image analysis software to measure organoid area over time. Calculate the swelling ratio (areat/areat0). The FIS response is a quantitative biomarker of functional CFTR rescue.
  • Data Interpretation: Compare the swelling kinetics and maximum ratio of treated vs. vehicle-treated organoids. A robust increase indicates effective pharmacological correction.

Visualizations

G PE Prime Editing System (PE2 protein, pegRNA, nicking sgRNA) Target Genomic DNA Target (CFTR F508del locus) PE->Target Binding Cas9-nickase binds target pegRNA hybridizes Target->Binding RT Reverse Transcriptase extends from pegRNA, copying correction Binding->RT Flap 3' flap with correction is formed RT->Flap Repair Cellular repair machinery integrates correction Flap->Repair Outcome Permanent genomic correction of F508del Repair->Outcome

Diagram 1: Prime editing mechanism for CFTR F508del correction.

G Drug Trikafta Components (Elexacaftor/Tezacaftor/Ivacaftor) Misfolded Misfolded F508del-CFTR Protein (Retained in ER) Drug->Misfolded Binds Stabilize Elexacaftor/Tezacaftor: Stabilize & promote ER export Misfolded->Stabilize Trafficked Trafficked CFTR Protein (At plasma membrane) Stabilize->Trafficked Potentiate Ivacaftor: Potentiates channel gating Trafficked->Potentiate Function Partial CFTR Ion Channel Function Restored Potentiate->Function

Diagram 2: Small molecule corrector mechanism for CFTR F508del.

G cluster_PE Prime Editing Workflow cluster_SM Small Molecule Testing Workflow Start CF Patient Cell Source (e.g., HBE, fibroblast) PE_Path Prime Editing Path Start->PE_Path SM_Path Small Molecule Path Start->SM_Path PE1 1. Design & deliver PE system PE_Path->PE1 SM1 1. Culture patient-derived organoids SM_Path->SM1 PE2 2. Enrich edited cells (optional) PE1->PE2 PE3 3. ALI differentiation (4-6 wks) PE2->PE3 PE4 4. Functional assay (Ussing chamber) PE3->PE4 PE_End Outcome: Permanent genomic correction PE4->PE_End SM2 2. Treat with corrector combo (24-48h) SM1->SM2 SM3 3. Forskolin-Induced Swelling (FIS) Assay SM2->SM3 SM_End Outcome: Pharmacological rescue metric SM3->SM_End

Diagram 3: Experimental workflows for CFTR correction strategies.

The Scientist's Toolkit: Research Reagent Solutions

Table 3: Essential Research Materials for CFTR Correction Studies

Item / Reagent Provider (Example) Function in Research
Prime Editor 2 (PE2) Plasmid Addgene (#132775) Core expression plasmid for the prime editor (Cas9 nickase-reverse transcriptase fusion).
pegRNA Cloning Backbone Addgene (#132777) Vector for efficient synthesis and cloning of pegRNA sequences.
CFBE41o- Cells (F508del/F508del) CFFT or commercial labs Standardized immortalized bronchial epithelial cell line for in vitro CFTR editing studies.
Primary HBE Cells (CF Donor) University tissue banks, commercial suppliers Gold-standard primary cells for physiological validation; require ALI culture.
Lonza P3 Primary Cell 4D-Nucleofector Kit Lonza Enables efficient delivery of ribonucleoprotein (RNP) complexes into hard-to-transfect primary HBE cells.
Trikafta Components (VX-445, VX-661, VX-770) Selleckchem, MedChemExpress Reference small molecules for in vitro pharmacological correction and comparative studies.
Matrigel for Organoid Culture Corning Basement membrane matrix essential for 3D growth and maintenance of patient-derived organoids.
Using Chamber System (e.g., VCC MC6) Physiologic Instruments Gold-standard apparatus for measuring transepithelial ion transport (CFTR function) in real-time.
CFTRinh-172 Sigma-Aldrich Specific CFTR channel inhibitor used to confirm CFTR-mediated currents in functional assays.
Next-Generation Sequencing Service Various core facilities (e.g., GENEWIZ) For unbiased, quantitative assessment of prime editing efficiency and off-target profiling.

Introduction Within the broader thesis on advancing therapeutic strategies for cystic fibrosis (CF), this Application Note provides a focused comparison of three precise genome-editing modalities for correcting the predominant CF-causing mutation, the F508del deletion in the CFTR gene. While prime editing offers a promising avenue, its performance must be contextualized against established alternatives: Adenine Base Editors (ABEs) and CRISPR-Cas9 Homology-Directed Repair (HDR). We evaluate these approaches on key quantitative metrics critical for therapeutic development, provide detailed protocols, and outline essential research tools.

Quantitative Performance Comparison

Table 1: Head-to-Head Comparison of Editing Strategies for F508del Correction

Metric CRISPR-Cas9 HDR (with dsDNA donor) Adenine Base Editor (ABE8e) Prime Editor (PE3) Ideal Therapeutic Target
Theoretical Correction Precise 3-bp insertion Converts TAG (stop) to TAC (Tyr)* Precise 3-bp insertion Precise restoration of "CTT" codon
Max Editing Efficiency (in vitro) 10-25% 50-65% 20-35% >50% with high purity
Indel Byproduct Rate 20-40% (at target site) <1% 1-5% 0%
On-target Purity (% Perfect Correction) Moderate High (but is it correct?) Very High 100%
Key Limitation Low HDR rate; high indel burden Not a direct reversal; creates a synonymous codon Lower efficiency than BEs N/A
Primary Delivery Vehicle AAV or LNPs for donor template RNP or AAV RNP or AAV Clinically viable vector

*Note: ABE strategy typically involves installing a "TAG" stop codon via a separate edit, then converting it to "TAC" (Tyrosine) to mimic the wild-type phenylalanine codon. This is not a direct reversal of F508del.


Experimental Protocols

Protocol 1: Side-by-Side Editing in CFBE41o- Cells

Objective: Compare correction efficiency and byproduct formation of HDR, ABE, and PE in a homozygous F508del bronchial epithelial cell line. Materials: CFBE41o- cells, nucleofection kit, sgRNA (5′-GCACCATTAAAGAAAATATCATCTTTGG-3′), SpCas9 protein, ABE8e mRNA or protein, PE2/PE3 mRNA or protein, ssODN or AAV6 HDR donor template.

  • Design & Preparation:

    • HDR: Design a 100-nt single-stranded oligodeoxynucleotide (ssODN) donor with homologous arms (50 nt each) centered on the 3-bp "CTT" insertion. Alternatively, clone this sequence into an AAV6 donor vector with ~800 bp homology arms.
    • ABE: Design an ABE8e sgRNA to position target adenine within the TAG stop codon (e.g., at the "A" in TAG on the non-transcribed strand).
    • PE: Design a prime editing guide RNA (pegRNA) with a 13-nt primer binding site (PBS) and a 10-nt RT template encoding the "CTT" insertion.
  • Cell Nucleofection: Culture CFBE41o- cells in standard medium. For each condition, nucleofect 2e5 cells per reaction.

    • HDR Condition: 100 nM SpCas9 RNP + 200 nM ssODN (or 1e4 vg/cell AAV6 donor post-nucleofection).
    • ABE Condition: 100 nM ABE8e RNP.
    • PE Condition: 100 nM PE2 or PE3 RNP + 200 nM nicking sgRNA (for PE3).
  • Analysis (7 days post-editing):

    • Harvest genomic DNA.
    • Perform targeted deep sequencing (Illumina MiSeq) of the CFTR exon 11 region (~300 bp amplicon).
    • Data Analysis: Quantify (i) percentage of reads with perfect 3-bp insertion, (ii) percentage of reads with the desired A•T to G•C conversion (for ABE), and (iii) indel spectrum.

Protocol 2: Functional Validation via Organoid Swelling Assay

Objective: Assess functional recovery of CFTR channel activity in edited patient-derived intestinal organoids.

  • Organoid Culture & Editing: Establish F508del/F508del patient-derived intestinal organoids. Electroporate organoid fragments with the RNP complexes from Protocol 1.
  • Forskolin-Induced Swelling (FIS) Assay: After 14 days of expansion, harvest and mechanically dissociate organoids. Seed 20-30 organoids per well in a Matrigel dome.
    • At Day 3, stimulate with 5 µM forskolin and 100 µM 3-isobutyl-1-methylxanthine (IBMX).
    • Acquire bright-field images every 30 minutes for 4 hours using a live-cell imager.
    • Quantify organoid area over time using ImageJ software. Calculate swelling ratio as (Area_final / Area_initial).
    • A significant increase in swelling ratio in edited organoids compared to unedited F508del controls indicates functional CFTR correction.

Visualizations

workflow Start Homozygous F508del Genomic Locus PE Prime Editor (PE3) System Start->PE HDR CRISPR-Cas9 + HDR Donor Start->HDR ABE Adenine Base Editor (ABE8e) Start->ABE Outcome_PE Precise 3-bp Insertion (CTT) PE->Outcome_PE Outcome_HDR Precise 3-bp Insertion (High Indel Risk) HDR->Outcome_HDR Outcome_ABE TAG (Stop) to TAC (Tyr) (Synonymous Codon) ABE->Outcome_ABE Val Functional Validation: Organoid Swelling Assay Outcome_PE->Val Outcome_HDR->Val Outcome_ABE->Val

Title: Workflow for F508del Editing Strategy Comparison

pathway WT Wild-Type CFTR: ...ATC ATC TTT... (Ile-508-Phe) Mut F508del Mutant: ...ATC --- TTT... (Ile-508 missing, Phe-509) WT->Mut ΔF508 Deletion ABEgoal ABE Intermediate: ...ATC TAG TTT... (Ile-Stop-Phe) Mut->ABEgoal Initial Editing (Install Stop) PEfinal PE Corrected: ...ATC ATC TTT... (Ile-508-Phe) Mut->PEfinal Prime Editing (Direct 3-bp Insertion) ABEfinal ABE 'Corrected': ...ATC TAC TTT... (Ile-Tyr-Phe) ABEgoal->ABEfinal ABE8e Editing (A•T to G•C)

Title: Molecular Outcomes of ABE vs. PE for F508del


The Scientist's Toolkit: Research Reagent Solutions

Table 2: Essential Reagents for F508del Correction Studies

Reagent Function/Application Key Consideration
CFBE41o- Cell Line Immortalized bronchial epithelial cell line homozygous for F508del; standard for in vitro editing efficiency assays. Maintain under rigorous antibiotic selection to preserve CFTR genotype.
Patient-Derived Intestinal Organoids (PDOs) Primary 3D culture model for assessing functional CFTR correction via Forskolin-Induced Swelling (FIS). Biobanked from CF patients; gold standard for functional validation.
SpCas9 Nuclease (Alt-R S.p. HiFi) High-fidelity Cas9 for HDR experiments; reduces off-target effects. Use HiFi variant to minimize indel byproducts during HDR.
ABE8e mRNA or Protein Engineered adenine base editor with high activity and expanded window. Optimize delivery format (mRNA vs. RNP) for your cell model.
PE2/PE3 mRNA or Protein Prime editor protein (PE2) and the optimized PE3 system with a nicking sgRNA. pegRNA design is critical; use computational tools (e.g., pegFinder).
Electroporation Nucleofector Device for high-efficiency delivery of RNPs/mRNA into hard-to-transfect epithelial cells and organoids. Optimize program and solution (e.g., P3 Primary Cell Kit).
AAV6 Serotype Vector High-efficiency delivery vehicle for HDR donor templates in primary cells and organoids. Titer accurately; control for donor-only background correction.
Targeted Deep Sequencing Kit Amplification and sequencing of the CFTR exon 11 locus to quantify editing outcomes and byproducts. Aim for >10,000x read depth per sample for accurate low-frequency variant detection.

This application note, framed within a broader thesis on CFTR F508del correction for cystic fibrosis (CF) research, provides a detailed comparison of Prime Editing (PE) and Antisense Oligonucleotide (ASO) therapeutic platforms. We focus on safety, specificity, and practical protocols for researchers and drug development professionals targeting the CFTR F508del mutation.

Quantitative Safety & Specificity Comparison

Table 1: Platform Characteristics & Safety Profile

Parameter Prime Editing (PE) Antisense Oligonucleotides (ASOs)
Primary Mechanism CRISPR-derived; reverse transcriptase-template "search-and-replace" of DNA. Complementary binding to target RNA to modulate splicing, translation, or degradation.
Therapeutic Goal for F508del Permanent correction of genomic DNA (TCT deletion in exon 10). Typically modulation of splicing (e.g., for other mutations) or suppression of nonsense-mediated decay; limited direct application for F508del.
Off-Target Risk (DNA) Low; requires PAM sequence and pegRNA complementarity. Potential for pegRNA-independent edits. None; does not interact with genomic DNA.
Off-Target Risk (RNA) Minimal (during pegRNA expression). High; potential for hybridization-dependent (sequence similarity) and -independent (protein binding) effects.
Genomic Integrity Risk Low but non-zero; potential for large deletions, translocations (double-strand break-free, but not zero risk). None.
Immunogenicity High risk: immune response to Cas9 protein and delivery vector (e.g., AAV). Moderate-High risk: immune stimulation (e.g., CpG motifs), chemistry-dependent.
Delivery Vehicle Primarily viral vectors (AAV, Lentivirus) or lipid nanoparticles (LNPs). Mostly unconjugated or GalNAc-conjugated; LNPs for extrahepatic delivery.
Therapeutic Durability Potentially permanent, single administration. Transient, requires repeated administration.
Key Toxicity Concerns Off-target edits, genomic instability, immune reactions, P53 activation. Thrombocytopenia, hepatotoxicity, renal toxicity, complement activation.

Table 2: Specificity Metrics from Recent Studies (2023-2024)

Metric Prime Editing (PE2/3 system) ASOs (Gapmer/Splice-switcher)
On-Target Efficiency (Model System) ~20-50% correction in CF patient-derived organoids. >80% target RNA engagement (splicing modulation).
Reported Off-Target DNA Edits <0.1% by whole-genome sequencing in cell lines. Not applicable.
Reported Off-Target RNA Effects Not systematically studied. Hundreds of transcriptomic changes observed via RNA-seq.
Clinical Stage Preclinical (in vivo proof-of-concept). Multiple approved drugs (e.g., Nusinersen, Eteplirsen).

Experimental Protocols

Protocol 1: Prime Editing for CFTR F508del Correction in HEK293T Cells

Aim: To correct the F508del mutation in a stably expressing HEK293T model cell line. Materials: See "Research Reagent Solutions" below. Method:

  • Design pegRNA and nicking sgRNA: Design pegRNA to encode the wild-type sequence "ATC TTT GGT GTT TCC" and a PBS of ~13 nt. Design a nicking sgRNA targeting the non-edited strand.
  • Cloning: Clone both RNA expression cassettes into a single plasmid backbone (e.g., pCMV-PE2).
  • Cell Culture: Maintain HEK293T-F508del cells in DMEM + 10% FBS.
  • Transfection: At 70% confluency in a 6-well plate, transfect with 2 µg PE plasmid using lipofectamine 3000 per manufacturer's protocol.
  • Harvest and Analysis: Harvest genomic DNA 72h post-transfection.
    • Primary Screening: Perform T7 Endonuclease I assay using primers flanking the target site.
    • Deep Sequencing: Amplify target locus by PCR and submit for next-generation amplicon sequencing to quantify correction efficiency and byproducts.

Protocol 2: Assessing ASO-Mediated Exon Skipping in CFTR Pre-mRNA

Aim: To induce skipping of exon 10 (containing F508del) to produce a shortened, potentially functional CFTR protein. Materials: 2'-O-Methoxyethyl (MOE) gapmer ASOs targeting splice sites of CFTR exon 10. Method:

  • ASO Design: Design 18-20mer MOE ASOs complementary to the 5' and 3' splice sites of exon 10.
  • Cell Culture & Transfection: Culture CF patient-derived bronchial epithelial cells (e.g., CFBE41o-) in appropriate media. Transfect with 100 nM ASO using a standard lipid transfection reagent.
  • RNA Isolation: 48h post-transfection, extract total RNA using a column-based kit.
  • RT-PCR Analysis: Perform RT-PCR with primers in exon 9 and exon 11. Analyze products on agarose gel. Successful exon skipping yields a shorter band.
  • Western Blot: Detect truncated CFTR protein using anti-CFTR antibodies.

Diagrams

G cluster_PE Prime Editing Workflow cluster_ASO ASO Therapeutic Workflow PE Prime Editing System PE1 1. pegRNA & PE2 Protein Complex Formation PE->PE1 ASO ASO System A1 1. Chemically Modified ASO Delivery ASO->A1 PE2 2. Target DNA Binding & Strand Nicking PE1->PE2 PE3 3. Reverse Transcription on DNA Template PE2->PE3 PE4 4. Flap Resolution & DNA Repair (Permanent Edit) PE3->PE4 PE_Out Corrected CFTR Gene (F508del -> WT) PE4->PE_Out A2 2. Cellular Uptake (Endocytosis) A1->A2 A3 3. Nuclear Localization & Target RNA Hybridization A2->A3 A4 4a. RNase H1 Recruitment (RNA Degradation) A3->A4 A5 4b. Splicing Modulation (Exon Inclusion/Exclusion) A3->A5 ASO_Out Altered CFTR Protein Expression A4->ASO_Out A5->ASO_Out

Diagram 1: Prime Editing vs ASO Mechanism Workflow (100 chars)

G cluster_Org Functional Assay: Organoid Forskolin Swelling F508del Genomic DNA: CFTR F508del PrimeEdit Prime Editor Delivery F508del->PrimeEdit CorrDNA Corrected DNA (WT Sequence) PrimeEdit->CorrDNA FuncCFTR Functional CFTR Protein at Membrane CorrDNA->FuncCFTR SW1 Transduce CF Intestinal Organoids FuncCFTR->SW1 SW2 Culture for 7-14 days SW1->SW2 SW3 Stimulate with Forskolin (cAMP agonist) SW2->SW3 SW4 Measure Swelling (Video Microscopy) SW3->SW4 SW5 Quantify % Correction via Swelling Kinetics SW4->SW5 SW5->FuncCFTR Validates

Diagram 2: Prime Edit Validation in CF Organoids (99 chars)

Research Reagent Solutions

Table 3: Essential Materials for CFTR Editing Experiments

Item Function Example Product/Catalog
PE2 Plasmid Expresses prime editor (Cas9-RT fusion) and allows pegRNA cloning. pCMV-PE2-P2A-GFP (Addgene #132775)
pegRNA Cloning Kit Facilitates rapid assembly of pegRNA expression cassettes. PE guide RNA toolkit (Addgene # #132786)
CF F508del Cell Line Disease-relevant model for in vitro editing. CFBE41o- (homozygous F508del) or patient-derived primary HBE cells.
Lipofectamine 3000 Transfection reagent for plasmid delivery into cell lines. Thermo Fisher L3000001
AAV6 Serotype Viral vector for efficient delivery of PE components to airway epithelia. AAV6-CMV-PE2 (custom)
Amplicon-EZ NGS Service Quantifies precise editing efficiency and byproducts. Genewiz Amplicon EZ or Illumina MiSeq.
MOE-modified ASOs Chemically stabilized oligonucleotides for splicing modulation. Custom synthesis from IDT or Ionis Pharmaceuticals.
Forskolin cAMP agonist used in the gold-standard functional assay for CFTR correction. Sigma-Aldisk F6886
Matrigel Basement membrane matrix for 3D culture of patient-derived organoids. Corning 356231

Conclusion

Prime editing represents a transformative, precision genetic medicine approach with the potential to directly correct the root cause of cystic fibrosis in patients with the F508del mutation. This review has synthesized the journey from foundational biology through methodological application, optimization, and comparative validation. While significant progress has been made in demonstrating proof-of-concept correction and functional rescue in model systems, key translational challenges remain. These include achieving high-efficiency, safe delivery to relevant tissues in vivo, mitigating immune responses, and scaling manufacturing. Future research must focus on advancing in vivo delivery systems, conducting long-term safety and durability studies in advanced models, and navigating the regulatory pathway. The convergence of optimized prime editors with sophisticated delivery platforms positions this technology as a leading candidate for the next generation of definitive CF therapies, moving beyond symptom management toward a permanent genetic cure.